Mutagenetix > Incidental Mutation

Incidental Mutation 'R6083:Grin2a'

482335

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

044242-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.423) question?

Stock #

R6083 (G1)

Quality Score

132.008

Status

Not validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9579540 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 894 (M894I)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

probably benign
Transcript: ENSMUST00000032331
AA Change: M894I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: M894I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115835
AA Change: M894I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: M894I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199708
AA Change: M894I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: M894I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	A	11: 58,878,851	P73Q	possibly damaging	Het
Aak1	A	T	6: 86,963,996	I591F	unknown	Het
Ace	C	A	11: 105,985,267	Y816*	probably null	Het
Ahnak2	A	G	12: 112,782,612	V1205A	probably benign	Het
Ahnak2	T	G	12: 112,782,999	Q1076P	probably benign	Het
Ap2a1	G	A	7: 44,907,751	R263W	probably damaging	Het
Arhgap29	A	G	3: 121,992,748	T257A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Ccdc17	A	T	4: 116,596,926	Q47L	possibly damaging	Het
Cep170	C	T	1: 176,774,625	R305H	probably damaging	Het
Cyb5r4	C	T	9: 87,057,168	P335S	probably damaging	Het
Cyp2c54	A	G	19: 40,073,762	L17P	probably benign	Het
Cyp2c69	A	T	19: 39,849,456	V394E	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Defb36	A	T	2: 152,604,488	M1L	unknown	Het
Dnaja1	A	G	4: 40,731,713	D263G	probably benign	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
Efnb2	T	C	8: 8,622,328		probably null	Het
Eif3e	A	G	15: 43,266,144	I196T	probably damaging	Het
Ercc4	T	A	16: 13,110,039	C24*	probably null	Het
Fmn1	A	G	2: 113,364,303	E116G	unknown	Het
Gnas	A	G	2: 174,297,862	M1V	probably null	Het
Herc2	G	T	7: 56,228,505	S4566I	probably benign	Het
Hmcn1	G	A	1: 150,755,293	P918L	probably damaging	Het
Hmcn1	G	T	1: 150,755,294	P918T	probably damaging	Het
Hsd3b2	T	A	3: 98,712,056	Y191F	possibly damaging	Het
Ifit1bl2	A	C	19: 34,619,817	F133C	possibly damaging	Het
Itih2	T	C	2: 10,108,894		probably benign	Het
Itsn1	T	C	16: 91,853,011	L191P	probably benign	Het
Kdr	T	C	5: 75,944,366	K1068R	probably damaging	Het
Lmtk2	T	C	5: 144,182,756	L1345P	probably damaging	Het
Man2b2	T	A	5: 36,809,041	D936V	probably damaging	Het
Mapk1ip1	G	A	7: 138,836,588	R38*	probably null	Het
Med13l	T	C	5: 118,721,486	V246A	possibly damaging	Het
Mlec	T	A	5: 115,148,049	T248S	probably benign	Het
Mslnl	T	A	17: 25,737,902	V54D	possibly damaging	Het
Muc16	G	A	9: 18,657,212	T1337I	unknown	Het
Nek7	C	T	1: 138,515,654	S187N	probably damaging	Het
Neto2	A	G	8: 85,640,585	V538A	probably benign	Het
Nktr	T	C	9: 121,750,136		probably benign	Het
Npy6r	A	G	18: 44,276,492	K327E	probably damaging	Het
Olfr1230	T	A	2: 89,297,024	D82V	probably damaging	Het
Olfr1245	T	C	2: 89,575,672	D18G	probably benign	Het
Olfr1463	A	T	19: 13,234,525	I92F	probably benign	Het
Olfr402	A	G	11: 74,155,570	M139V	possibly damaging	Het
Olfr705	A	G	7: 106,873,582	I221T	probably damaging	Het
Pcdhga4	A	T	18: 37,687,425	N676Y	probably damaging	Het
Pde2a	T	C	7: 101,502,879	I331T	possibly damaging	Het
Pip5k1b	A	T	19: 24,304,035	Y486*	probably null	Het
Plch2	A	G	4: 155,000,818	M272T	probably benign	Het
Rbm12	G	A	2: 156,097,726		probably benign	Het
Rgs19	T	C	2: 181,689,507	E111G	probably damaging	Het
Rhbdf1	T	C	11: 32,210,066	N145S	probably damaging	Het
Rnf4	T	A	5: 34,351,221		probably null	Het
Rpa1	T	C	11: 75,314,911	T207A	probably damaging	Het
Rufy4	A	C	1: 74,129,397	Q113P	probably damaging	Het
Sh3pxd2b	T	G	11: 32,422,985	S717R	probably benign	Het
Sin3a	A	T	9: 57,107,540	I682F	probably damaging	Het
Sipa1l2	A	T	8: 125,468,473	V842E	possibly damaging	Het
Slc5a4a	A	G	10: 76,147,597	I23V	unknown	Het
Slitrk5	A	G	14: 111,681,725	N927S	probably benign	Het
Smc6	A	G	12: 11,276,353	K117R	possibly damaging	Het
Sod2	G	A	17: 13,008,031		probably benign	Het
Stxbp1	A	G	2: 32,796,018	I567T	possibly damaging	Het
Tbkbp1	C	A	11: 97,147,380	L209F	probably damaging	Het
Tll1	G	T	8: 64,038,586		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Trim30b	A	G	7: 104,366,142	V13A	probably damaging	Het
Trip11	G	A	12: 101,889,742	T425I	probably benign	Het
Ttn	C	A	2: 76,889,973		probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Ush2a	T	A	1: 188,267,023	S177T	probably damaging	Het
Usp40	A	T	1: 87,978,559	S651R	probably benign	Het
Vmn1r125	T	C	7: 21,272,719	S181P	probably damaging	Het
Vmn1r198	T	A	13: 22,354,758	V138D	possibly damaging	Het
Vmn1r56	A	G	7: 5,196,318	L100P	probably damaging	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r53	A	C	7: 12,581,881	H670Q	probably benign	Het
Vmn2r69	A	T	7: 85,406,503	I809N	probably damaging	Het
Wdr7	G	A	18: 63,728,469	G184D	probably damaging	Het
Wnk1	C	T	6: 120,037,601	G11D	probably damaging	Het
Zfp110	A	C	7: 12,844,675	E171A	possibly damaging	Het
Zkscan6	T	C	11: 65,815,931	V134A	probably damaging	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TGGCCACAAATGTTTGCAG -3'
(R):5'- CATACTTCAACTTTGCAGGTAAAGC -3'

Posted On

2017-07-14