Mutagenetix > Incidental Mutations

Incidental Mutation 'R6083:Wdr7'

482342

Institutional Source

Beutler Lab

Gene Symbol

Wdr7

Ensembl Gene

ENSMUSG00000040560

Gene Name

WD repeat domain 7

Synonyms

TGF-beta resistance associated gene, TRAG

MMRRC Submission

044242-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R6083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63708695-63989760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63728469 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 184 (G184D)

Ref Sequence

ENSEMBL: ENSMUSP00000072509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072726]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072726
AA Change: G184D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: G184D

Domain	Start	End	E-Value	Type
WD40	5	47	1.2e-2	SMART
WD40	53	95	3.71e-1	SMART
Blast:WD40	145	190	1e-18	BLAST
WD40	208	242	1.77e2	SMART
WD40	453	498	3.81e-5	SMART
WD40	501	546	4.26e1	SMART
WD40	549	588	1.63e-4	SMART
low complexity region	760	777	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC
low complexity region	956	970	N/A	INTRINSIC
low complexity region	1020	1040	N/A	INTRINSIC
low complexity region	1181	1192	N/A	INTRINSIC
Blast:WD40	1341	1380	5e-20	BLAST
WD40	1382	1422	2.73e-6	SMART

Meta Mutation Damage Score

0.7128

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	A	11: 58,878,851	P73Q	possibly damaging	Het
Aak1	A	T	6: 86,963,996	I591F	unknown	Het
Ace	C	A	11: 105,985,267	Y816*	probably null	Het
Ahnak2	A	G	12: 112,782,612	V1205A	probably benign	Het
Ahnak2	T	G	12: 112,782,999	Q1076P	probably benign	Het
Ap2a1	G	A	7: 44,907,751	R263W	probably damaging	Het
Arhgap29	A	G	3: 121,992,748	T257A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Ccdc17	A	T	4: 116,596,926	Q47L	possibly damaging	Het
Cep170	C	T	1: 176,774,625	R305H	probably damaging	Het
Cyb5r4	C	T	9: 87,057,168	P335S	probably damaging	Het
Cyp2c54	A	G	19: 40,073,762	L17P	probably benign	Het
Cyp2c69	A	T	19: 39,849,456	V394E	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Defb36	A	T	2: 152,604,488	M1L	unknown	Het
Dnaja1	A	G	4: 40,731,713	D263G	probably benign	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
Efnb2	T	C	8: 8,622,328		probably null	Het
Eif3e	A	G	15: 43,266,144	I196T	probably damaging	Het
Ercc4	T	A	16: 13,110,039	C24*	probably null	Het
Fmn1	A	G	2: 113,364,303	E116G	unknown	Het
Gnas	A	G	2: 174,297,862	M1V	probably null	Het
Grin2a	C	A	16: 9,579,540	M894I	probably benign	Het
Herc2	G	T	7: 56,228,505	S4566I	probably benign	Het
Hmcn1	G	A	1: 150,755,293	P918L	probably damaging	Het
Hmcn1	G	T	1: 150,755,294	P918T	probably damaging	Het
Hsd3b2	T	A	3: 98,712,056	Y191F	possibly damaging	Het
Ifit1bl2	A	C	19: 34,619,817	F133C	possibly damaging	Het
Itih2	T	C	2: 10,108,894		probably benign	Het
Itsn1	T	C	16: 91,853,011	L191P	probably benign	Het
Kdr	T	C	5: 75,944,366	K1068R	probably damaging	Het
Lmtk2	T	C	5: 144,182,756	L1345P	probably damaging	Het
Man2b2	T	A	5: 36,809,041	D936V	probably damaging	Het
Mapk1ip1	G	A	7: 138,836,588	R38*	probably null	Het
Med13l	T	C	5: 118,721,486	V246A	possibly damaging	Het
Mlec	T	A	5: 115,148,049	T248S	probably benign	Het
Mslnl	T	A	17: 25,737,902	V54D	possibly damaging	Het
Muc16	G	A	9: 18,657,212	T1337I	unknown	Het
Nek7	C	T	1: 138,515,654	S187N	probably damaging	Het
Neto2	A	G	8: 85,640,585	V538A	probably benign	Het
Nktr	T	C	9: 121,750,136		probably benign	Het
Npy6r	A	G	18: 44,276,492	K327E	probably damaging	Het
Olfr1230	T	A	2: 89,297,024	D82V	probably damaging	Het
Olfr1245	T	C	2: 89,575,672	D18G	probably benign	Het
Olfr1463	A	T	19: 13,234,525	I92F	probably benign	Het
Olfr402	A	G	11: 74,155,570	M139V	possibly damaging	Het
Olfr705	A	G	7: 106,873,582	I221T	probably damaging	Het
Pcdhga4	A	T	18: 37,687,425	N676Y	probably damaging	Het
Pde2a	T	C	7: 101,502,879	I331T	possibly damaging	Het
Pip5k1b	A	T	19: 24,304,035	Y486*	probably null	Het
Plch2	A	G	4: 155,000,818	M272T	probably benign	Het
Rbm12	G	A	2: 156,097,726		probably benign	Het
Rgs19	T	C	2: 181,689,507	E111G	probably damaging	Het
Rhbdf1	T	C	11: 32,210,066	N145S	probably damaging	Het
Rnf4	T	A	5: 34,351,221		probably null	Het
Rpa1	T	C	11: 75,314,911	T207A	probably damaging	Het
Rufy4	A	C	1: 74,129,397	Q113P	probably damaging	Het
Sh3pxd2b	T	G	11: 32,422,985	S717R	probably benign	Het
Sin3a	A	T	9: 57,107,540	I682F	probably damaging	Het
Sipa1l2	A	T	8: 125,468,473	V842E	possibly damaging	Het
Slc5a4a	A	G	10: 76,147,597	I23V	unknown	Het
Slitrk5	A	G	14: 111,681,725	N927S	probably benign	Het
Smc6	A	G	12: 11,276,353	K117R	possibly damaging	Het
Sod2	G	A	17: 13,008,031		probably benign	Het
Stxbp1	A	G	2: 32,796,018	I567T	possibly damaging	Het
Tbkbp1	C	A	11: 97,147,380	L209F	probably damaging	Het
Tll1	G	T	8: 64,038,586		probably null	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Trim30b	A	G	7: 104,366,142	V13A	probably damaging	Het
Trip11	G	A	12: 101,889,742	T425I	probably benign	Het
Ttn	C	A	2: 76,889,973		probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Ush2a	T	A	1: 188,267,023	S177T	probably damaging	Het
Usp40	A	T	1: 87,978,559	S651R	probably benign	Het
Vmn1r125	T	C	7: 21,272,719	S181P	probably damaging	Het
Vmn1r198	T	A	13: 22,354,758	V138D	possibly damaging	Het
Vmn1r56	A	G	7: 5,196,318	L100P	probably damaging	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r53	A	C	7: 12,581,881	H670Q	probably benign	Het
Vmn2r69	A	T	7: 85,406,503	I809N	probably damaging	Het
Wnk1	C	T	6: 120,037,601	G11D	probably damaging	Het
Zfp110	A	C	7: 12,844,675	E171A	possibly damaging	Het
Zkscan6	T	C	11: 65,815,931	V134A	probably damaging	Het

Other mutations in Wdr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Wdr7	APN	18	63720775	missense	possibly damaging	0.83
IGL00708:Wdr7	APN	18	63778033	missense	probably benign	0.42
IGL00813:Wdr7	APN	18	63735604	missense	possibly damaging	0.84
IGL00840:Wdr7	APN	18	63927327	missense	possibly damaging	0.80
IGL00904:Wdr7	APN	18	63796231	missense	probably benign	0.43
IGL00930:Wdr7	APN	18	63740244	nonsense	probably null
IGL01481:Wdr7	APN	18	63739179	missense	probably damaging	1.00
IGL02121:Wdr7	APN	18	63777545	nonsense	probably null
IGL02346:Wdr7	APN	18	63865336	missense	probably benign	0.09
IGL02454:Wdr7	APN	18	63796228	missense	probably benign	0.20
IGL02538:Wdr7	APN	18	63796235	missense	probably benign	0.01
IGL02870:Wdr7	APN	18	63791843	missense	probably benign
IGL03054:Wdr7	APN	18	63825121	splice site	probably benign
IGL03189:Wdr7	APN	18	63760601	missense	probably benign	0.17
R0014:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0022:Wdr7	UTSW	18	63777634	missense	probably damaging	1.00
R0233:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0432:Wdr7	UTSW	18	63796249	missense	probably damaging	0.96
R0496:Wdr7	UTSW	18	63791843	missense	probably benign
R0633:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R0931:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R1585:Wdr7	UTSW	18	63924918	missense	probably benign	0.03
R1651:Wdr7	UTSW	18	63720776	nonsense	probably null
R1804:Wdr7	UTSW	18	63865440	missense	probably damaging	1.00
R1874:Wdr7	UTSW	18	63728504	missense	probably benign	0.02
R1985:Wdr7	UTSW	18	63760583	frame shift	probably null
R2106:Wdr7	UTSW	18	63778038	missense	probably damaging	1.00
R2206:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2207:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2245:Wdr7	UTSW	18	63924909	missense	possibly damaging	0.60
R2407:Wdr7	UTSW	18	63760723	missense	probably benign
R3804:Wdr7	UTSW	18	63720836	missense	probably benign
R3880:Wdr7	UTSW	18	63724155	missense	possibly damaging	0.92
R4410:Wdr7	UTSW	18	63778249	missense	probably damaging	1.00
R4441:Wdr7	UTSW	18	63755210	missense	probably damaging	1.00
R4485:Wdr7	UTSW	18	63777550	missense	possibly damaging	0.89
R4606:Wdr7	UTSW	18	63779945	nonsense	probably null
R4607:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4608:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4711:Wdr7	UTSW	18	63728465	missense	probably benign
R4852:Wdr7	UTSW	18	63777949	missense	probably damaging	0.98
R5197:Wdr7	UTSW	18	63738866	missense	probably benign	0.02
R5213:Wdr7	UTSW	18	63755126	missense	probably damaging	1.00
R5280:Wdr7	UTSW	18	63987312	missense	probably benign	0.35
R5378:Wdr7	UTSW	18	63825239	critical splice donor site	probably null
R6076:Wdr7	UTSW	18	63739277	missense	probably damaging	1.00
R6168:Wdr7	UTSW	18	63777977	missense	probably damaging	0.98
R6234:Wdr7	UTSW	18	63724132	missense	probably damaging	1.00
R6295:Wdr7	UTSW	18	63755111	missense	probably damaging	1.00
R6548:Wdr7	UTSW	18	63778251	missense	possibly damaging	0.87
R6566:Wdr7	UTSW	18	63755055	missense	possibly damaging	0.72
R6696:Wdr7	UTSW	18	63739330	missense	probably benign	0.07
R6937:Wdr7	UTSW	18	63791867	missense	probably benign
R6962:Wdr7	UTSW	18	63865288	missense	possibly damaging	0.74
R7162:Wdr7	UTSW	18	63724139	missense	possibly damaging	0.92
R7376:Wdr7	UTSW	18	63777620	missense	probably damaging	1.00
R7423:Wdr7	UTSW	18	63777380	splice site	probably null
R7781:Wdr7	UTSW	18	63777789	nonsense	probably null
R7851:Wdr7	UTSW	18	63720327	missense	probably benign	0.05
R7962:Wdr7	UTSW	18	63904086	missense	probably damaging	1.00
R8310:Wdr7	UTSW	18	63735685	missense	probably damaging	0.98
R8325:Wdr7	UTSW	18	63778464	splice site	probably null
R8520:Wdr7	UTSW	18	63987160	missense	probably benign	0.09
R8678:Wdr7	UTSW	18	63777697	missense	probably damaging	1.00
R8847:Wdr7	UTSW	18	63739222	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTCACTGAAAACCATGAGG -3'
(R):5'- AGGCTCTTTTCCAATATGTGCAAG -3'

Posted On

2017-07-14