Incidental Mutation 'R6083:Ifit1bl2'
ID482345
Institutional Source Beutler Lab
Gene Symbol Ifit1bl2
Ensembl Gene ENSMUSG00000067297
Gene Nameinterferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms2010002M12Rik
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6083 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34617049-34640743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34619817 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 133 (F133C)
Ref Sequence ENSEMBL: ENSMUSP00000108082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087357
AA Change: F133C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297
AA Change: F133C

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112463
AA Change: F133C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297
AA Change: F133C

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Meta Mutation Damage Score 0.2849 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Ifit1bl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ifit1bl2 APN 19 34619919 missense probably benign 0.22
IGL00706:Ifit1bl2 APN 19 34618882 missense probably benign 0.09
IGL01322:Ifit1bl2 APN 19 34619004 missense probably benign 0.10
IGL01362:Ifit1bl2 APN 19 34619484 missense probably benign 0.04
IGL03061:Ifit1bl2 APN 19 34619724 missense probably benign 0.41
R0039:Ifit1bl2 UTSW 19 34619446 nonsense probably null
R1079:Ifit1bl2 UTSW 19 34619485 missense probably benign 0.00
R1438:Ifit1bl2 UTSW 19 34619169 missense possibly damaging 0.70
R2050:Ifit1bl2 UTSW 19 34619470 missense possibly damaging 0.75
R2104:Ifit1bl2 UTSW 19 34619520 missense probably benign 0.01
R2228:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R2229:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R4468:Ifit1bl2 UTSW 19 34619068 nonsense probably null
R4517:Ifit1bl2 UTSW 19 34629764 start gained probably benign
R5723:Ifit1bl2 UTSW 19 34620058 missense probably benign 0.07
R5935:Ifit1bl2 UTSW 19 34619728 missense probably benign 0.04
R6024:Ifit1bl2 UTSW 19 34620038 missense probably benign 0.00
R6085:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6280:Ifit1bl2 UTSW 19 34620134 missense possibly damaging 0.70
R6368:Ifit1bl2 UTSW 19 34619125 missense probably benign 0.00
R6905:Ifit1bl2 UTSW 19 34619590 missense possibly damaging 0.90
R7048:Ifit1bl2 UTSW 19 34619151 missense probably benign 0.04
R7355:Ifit1bl2 UTSW 19 34619661 missense probably damaging 1.00
R7447:Ifit1bl2 UTSW 19 34619574 missense probably damaging 1.00
R7661:Ifit1bl2 UTSW 19 34619028 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATCTGCATAGCCAGCGTTG -3'
(R):5'- TCCCATCTACAGCATCGGGATG -3'

Posted On2017-07-14