Incidental Mutation 'R6084:Olfr1288'
ID 482354
Institutional Source Beutler Lab
Gene Symbol Olfr1288
Ensembl Gene ENSMUSG00000044039
Gene Name olfactory receptor 1288
Synonyms MOR245-9, GA_x6K02T2Q125-72530279-72531217
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6084 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 111474101-111479994 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 111479389 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 202 (N202Y)
Ref Sequence ENSEMBL: ENSMUSP00000150331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816]
AlphaFold Q7TQY0
Predicted Effect probably damaging
Transcript: ENSMUST00000104889
AA Change: N202Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039
AA Change: N202Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect probably benign
Transcript: ENSMUST00000207494
Predicted Effect probably damaging
Transcript: ENSMUST00000214816
AA Change: N202Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Olfr1288
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Olfr1288 APN 2 111478864 missense probably benign
IGL02021:Olfr1288 APN 2 111479480 missense probably benign 0.03
IGL02061:Olfr1288 APN 2 111479269 missense possibly damaging 0.94
R2016:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2017:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2848:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R2849:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R3421:Olfr1288 UTSW 2 111478952 missense probably benign 0.12
R4223:Olfr1288 UTSW 2 111479144 missense probably benign 0.00
R4432:Olfr1288 UTSW 2 111479412 nonsense probably null
R4433:Olfr1288 UTSW 2 111479412 nonsense probably null
R4476:Olfr1288 UTSW 2 111479664 missense possibly damaging 0.58
R4631:Olfr1288 UTSW 2 111479563 missense probably damaging 1.00
R6029:Olfr1288 UTSW 2 111478965 nonsense probably null
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6329:Olfr1288 UTSW 2 111479228 missense possibly damaging 0.90
R7307:Olfr1288 UTSW 2 111478760 start gained probably benign
R7516:Olfr1288 UTSW 2 111478937 missense probably benign 0.01
R7577:Olfr1288 UTSW 2 111479132 missense probably damaging 0.98
R8108:Olfr1288 UTSW 2 111479234 missense possibly damaging 0.90
R8210:Olfr1288 UTSW 2 111479408 missense possibly damaging 0.89
R8465:Olfr1288 UTSW 2 111479080 missense probably benign 0.01
R8717:Olfr1288 UTSW 2 111479647 missense probably damaging 1.00
R8730:Olfr1288 UTSW 2 111479589 missense probably damaging 1.00
R9360:Olfr1288 UTSW 2 111479339 missense probably benign 0.10
Z1177:Olfr1288 UTSW 2 111478814 missense probably benign 0.06
Z1177:Olfr1288 UTSW 2 111479207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTACCTGATGATCATGAATCCC -3'
(R):5'- TGACTTGGTCGGAAATGGCC -3'

Posted On 2017-07-14