Mutagenetix > Incidental Mutations

Incidental Mutation 'R6084:Lpin3'

482359

Institutional Source

Beutler Lab

Gene Symbol

Lpin3

Ensembl Gene

ENSMUSG00000027412

Gene Name

lipin 3

Synonyms

9130206L11Rik

MMRRC Submission

044243-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6084 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160880670-160906002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160895801 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 197 (Y197C)

Ref Sequence

ENSEMBL: ENSMUSP00000105082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]

AlphaFold

Q99PI4

Predicted Effect

probably benign
Transcript: ENSMUST00000040872
AA Change: Y197C

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: Y197C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109455
AA Change: Y197C

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: Y197C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.4e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	528	538	N/A	INTRINSIC
LNS2	606	762	1.4e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109456
AA Change: Y197C

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: Y197C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109457
AA Change: Y197C

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: Y197C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	4.1e-48	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
Pfam:Lipin_mid	435	538	9.5e-35	PFAM
low complexity region	569	579	N/A	INTRINSIC
LNS2	647	803	1.4e-105	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	T	C	5: 62,670,954	D958G	possibly damaging	Het
Bag4	T	C	8: 25,771,231	T161A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cacna2d2	T	C	9: 107,497,521		probably null	Het
Cass4	G	T	2: 172,426,912	A307S	probably benign	Het
Cbln4	A	T	2: 172,042,096	V68E	probably damaging	Het
Cc2d2a	T	A	5: 43,668,673	N2K	probably benign	Het
Ccnf	T	A	17: 24,231,837	D389V	probably damaging	Het
Cdipt	T	C	7: 126,979,601	S161P	probably benign	Het
Ceacam19	T	C	7: 19,882,887	I161V	probably benign	Het
Cfap65	A	G	1: 74,920,405	I862T	probably damaging	Het
Cfi	T	A	3: 129,858,370	L230Q	probably benign	Het
Chac2	G	A	11: 30,986,159	R30W	probably damaging	Het
Cmc2	G	A	8: 116,889,827		probably benign	Het
Col1a2	A	T	6: 4,505,840	M1L	probably benign	Het
Cox8a	C	A	19: 7,217,418	R32L	possibly damaging	Het
Cubn	T	A	2: 13,430,897	N1083Y	probably damaging	Het
D430042O09Rik	G	A	7: 125,814,865	G394R	probably benign	Het
D630003M21Rik	T	C	2: 158,217,584	D132G	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dnaaf3	T	C	7: 4,524,213	D358G	probably benign	Het
Dysf	T	A	6: 84,019,604	F29L	probably damaging	Het
Dysf	T	C	6: 84,112,119	L888P	probably damaging	Het
Ebf4	A	G	2: 130,309,723	D277G	probably damaging	Het
Ecm2	T	A	13: 49,515,094	L91*	probably null	Het
Foxs1	T	C	2: 152,932,842	D97G	possibly damaging	Het
Frs2	A	C	10: 117,076,809		probably null	Het
Gm6768	A	G	12: 119,261,651		noncoding transcript	Het
Grp	A	T	18: 65,879,937	D58V	probably damaging	Het
Hif1a	T	G	12: 73,941,842	F537C	probably damaging	Het
Icam4	G	A	9: 21,029,539	S29N	probably benign	Het
Itfg1	T	C	8: 85,726,170	E523G	probably benign	Het
Jph2	T	C	2: 163,375,680	K359E	probably damaging	Het
Kcnq2	A	T	2: 181,087,656	V490E	possibly damaging	Het
Klhl18	C	T	9: 110,428,727	M548I	possibly damaging	Het
Lrp1	T	C	10: 127,560,553	N2381D	probably benign	Het
Man1a	A	T	10: 53,919,211	W649R	probably damaging	Het
Map4	T	C	9: 110,064,292	L542P	probably damaging	Het
Mboat2	A	T	12: 24,878,285	H52L	probably damaging	Het
Mok	C	G	12: 110,814,946	S91T	probably benign	Het
Mtmr11	G	T	3: 96,168,084	R360L	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Olfr1288	A	T	2: 111,479,389	N202Y	probably damaging	Het
Olfr341	A	G	2: 36,479,512	V206A	probably benign	Het
Olfr544	T	C	7: 102,484,389	T244A	probably damaging	Het
Olfr67	C	T	7: 103,787,955	M107I	probably benign	Het
Olfr836	A	G	9: 19,121,327	D121G	probably damaging	Het
Olfr867	A	T	9: 20,054,883	H75Q	possibly damaging	Het
Padi3	G	T	4: 140,795,843	T292N	probably damaging	Het
Pard6g	A	C	18: 80,117,205	T178P	possibly damaging	Het
Pkd1l2	A	T	8: 117,013,987	Y2124N	probably damaging	Het
Plxdc1	G	A	11: 97,928,463	T398I	probably damaging	Het
Prickle2	A	T	6: 92,416,848	C225*	probably null	Het
Prmt2	G	A	10: 76,210,444	T317I	probably benign	Het
Psg22	T	G	7: 18,719,780	N172K	probably benign	Het
Ptpn9	C	T	9: 57,033,163	R196*	probably null	Het
Rap1b	C	T	10: 117,824,611	V14I	probably damaging	Het
Rapgef4	T	A	2: 72,196,278		probably null	Het
Rlf	A	T	4: 121,149,215	M856K	possibly damaging	Het
Rnf149	A	G	1: 39,577,174	L34P	probably benign	Het
Rock1	T	C	18: 10,101,007	E636G	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Ryr3	T	C	2: 112,908,493	H563R	probably damaging	Het
Slc18b1	A	G	10: 23,804,212	M102V	probably benign	Het
Slc34a2	T	A	5: 53,067,647	C377S	possibly damaging	Het
Slco1c1	T	C	6: 141,546,770	V293A	probably benign	Het
Spidr	A	T	16: 16,140,024	S80T	possibly damaging	Het
Syne1	C	T	10: 5,348,994	E1031K	probably damaging	Het
Synj2	G	A	17: 6,017,614	V121I	probably damaging	Het
Synj2	A	T	17: 6,038,098	T1430S	probably damaging	Het
Tecpr2	G	T	12: 110,929,109	K343N	probably damaging	Het
Tmem132d	T	A	5: 127,784,100	I986F	probably benign	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Ttll10	T	A	4: 156,045,357	D283V	probably benign	Het
Ttn	T	A	2: 76,814,779	K673*	probably null	Het
Ubqlnl	T	A	7: 104,148,698	M531L	probably benign	Het
Vmn2r120	A	T	17: 57,525,721	W153R	probably benign	Het
Vmn2r2	A	C	3: 64,117,046	S705A	probably benign	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r54	T	A	7: 12,632,278	Q243L	probably damaging	Het
Wdr24	C	A	17: 25,824,530	R109S	probably damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp426	G	T	9: 20,470,627	Q341K	possibly damaging	Het
Zfp616	A	T	11: 74,083,846	K314*	probably null	Het

Other mutations in Lpin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Lpin3	APN	2	160893998	missense	probably damaging	1.00
IGL01373:Lpin3	APN	2	160903729	missense	probably damaging	1.00
IGL01576:Lpin3	APN	2	160897127	missense	probably benign	0.02
IGL02124:Lpin3	APN	2	160895833	critical splice donor site	probably null
IGL02272:Lpin3	APN	2	160901661	missense	probably benign	0.15
IGL02314:Lpin3	APN	2	160898718	nonsense	probably null
IGL02374:Lpin3	APN	2	160895838	splice site	probably benign
IGL02554:Lpin3	APN	2	160896787	missense	probably damaging	1.00
IGL02693:Lpin3	APN	2	160905055	missense	probably damaging	1.00
IGL02858:Lpin3	APN	2	160898620	splice site	probably benign
IGL03143:Lpin3	APN	2	160903598	splice site	probably benign
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0329:Lpin3	UTSW	2	160905305	missense	probably benign
R0330:Lpin3	UTSW	2	160905305	missense	probably benign
R0570:Lpin3	UTSW	2	160904024	splice site	probably benign
R0633:Lpin3	UTSW	2	160903974	missense	probably damaging	0.99
R0781:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1109:Lpin3	UTSW	2	160899021	missense	probably damaging	1.00
R1110:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1513:Lpin3	UTSW	2	160904548	missense	probably damaging	1.00
R1543:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R1785:Lpin3	UTSW	2	160896809	nonsense	probably null
R1786:Lpin3	UTSW	2	160896809	nonsense	probably null
R1896:Lpin3	UTSW	2	160905298	missense	probably damaging	1.00
R4440:Lpin3	UTSW	2	160898645	missense	probably benign
R4470:Lpin3	UTSW	2	160895434	missense	probably benign	0.00
R4996:Lpin3	UTSW	2	160905287	missense	probably damaging	1.00
R5014:Lpin3	UTSW	2	160904828	missense	probably damaging	1.00
R5124:Lpin3	UTSW	2	160897061	missense	probably benign
R5184:Lpin3	UTSW	2	160897138	missense	probably benign
R5405:Lpin3	UTSW	2	160903929	missense	probably damaging	1.00
R5442:Lpin3	UTSW	2	160905016	missense	probably damaging	1.00
R5666:Lpin3	UTSW	2	160897330	missense	probably benign
R5670:Lpin3	UTSW	2	160897330	missense	probably benign
R5693:Lpin3	UTSW	2	160895400	missense	probably benign	0.00
R6994:Lpin3	UTSW	2	160904883	missense	probably damaging	1.00
R7090:Lpin3	UTSW	2	160896752	missense	probably damaging	0.96
R7157:Lpin3	UTSW	2	160898707	missense	probably benign	0.02
R7207:Lpin3	UTSW	2	160894003	nonsense	probably null
R7430:Lpin3	UTSW	2	160898666	missense	probably benign	0.06
R7459:Lpin3	UTSW	2	160897300	missense	probably benign	0.06
R7603:Lpin3	UTSW	2	160903754	splice site	probably null
R7644:Lpin3	UTSW	2	160896770	missense	probably benign	0.02
R7706:Lpin3	UTSW	2	160905290	missense	probably damaging	1.00
R7803:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R8443:Lpin3	UTSW	2	160895353	missense	probably damaging	1.00
R8985:Lpin3	UTSW	2	160896754	missense	probably benign	0.00
R9288:Lpin3	UTSW	2	160903632	missense	probably damaging	1.00
R9385:Lpin3	UTSW	2	160897073	missense	probably benign
X0002:Lpin3	UTSW	2	160903717	missense	probably damaging	1.00
Z1088:Lpin3	UTSW	2	160892231	missense	probably damaging	0.99
Z1176:Lpin3	UTSW	2	160899785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACATTTCTTCTGCGGATGCTG -3'
(R):5'- AGTTTGATCCTTAGCCCAAACTG -3'

Posted On

2017-07-14