Mutagenetix > Incidental Mutations

Incidental Mutation 'R6084:Jph2'

482360

Institutional Source

Beutler Lab

Gene Symbol

Jph2

Ensembl Gene

ENSMUSG00000017817

Gene Name

junctophilin 2

Synonyms

1110002E14Rik, JP-2

MMRRC Submission

044243-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6084 (G1)

Quality Score

189.009

Status

Not validated

Chromosome

Chromosomal Location

163336242-163397993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 163375680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 359 (K359E)

Ref Sequence

ENSEMBL: ENSMUSP00000105052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017961] [ENSMUST00000109425]

AlphaFold

Q9ET78

Predicted Effect

probably damaging
Transcript: ENSMUST00000017961
AA Change: K359E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000017961
Gene: ENSMUSG00000017817
AA Change: K359E

Domain	Start	End	E-Value	Type
MORN	12	33	7.12e0	SMART
MORN	58	79	3.01e0	SMART
Pfam:MORN	82	103	1.2e-2	PFAM
MORN	104	125	4.99e-5	SMART
MORN	127	148	3.67e-3	SMART
low complexity region	153	168	N/A	INTRINSIC
low complexity region	198	208	N/A	INTRINSIC
low complexity region	212	234	N/A	INTRINSIC
low complexity region	246	279	N/A	INTRINSIC
MORN	283	304	3.61e-2	SMART
MORN	306	327	6.23e-6	SMART
low complexity region	367	382	N/A	INTRINSIC
low complexity region	388	402	N/A	INTRINSIC
low complexity region	432	448	N/A	INTRINSIC
low complexity region	473	487	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
low complexity region	588	612	N/A	INTRINSIC
low complexity region	656	671	N/A	INTRINSIC
transmembrane domain	673	695	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109425
AA Change: K359E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105052
Gene: ENSMUSG00000017817
AA Change: K359E

Domain	Start	End	E-Value	Type
MORN	12	33	7.12e0	SMART
MORN	58	79	3.01e0	SMART
MORN	104	125	4.99e-5	SMART
MORN	127	148	3.67e-3	SMART
low complexity region	153	168	N/A	INTRINSIC
low complexity region	198	208	N/A	INTRINSIC
low complexity region	212	234	N/A	INTRINSIC
low complexity region	246	279	N/A	INTRINSIC
MORN	283	304	3.61e-2	SMART
MORN	306	327	6.23e-6	SMART
low complexity region	367	382	N/A	INTRINSIC
low complexity region	388	402	N/A	INTRINSIC
low complexity region	432	448	N/A	INTRINSIC
low complexity region	473	487	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
low complexity region	588	612	N/A	INTRINSIC
low complexity region	656	671	N/A	INTRINSIC
transmembrane domain	673	695	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a deficiency of junctional membrane complexes in cardiac myocytes and die by embryonic day 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	T	C	5: 62,670,954	D958G	possibly damaging	Het
Bag4	T	C	8: 25,771,231	T161A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cacna2d2	T	C	9: 107,497,521		probably null	Het
Cass4	G	T	2: 172,426,912	A307S	probably benign	Het
Cbln4	A	T	2: 172,042,096	V68E	probably damaging	Het
Cc2d2a	T	A	5: 43,668,673	N2K	probably benign	Het
Ccnf	T	A	17: 24,231,837	D389V	probably damaging	Het
Cdipt	T	C	7: 126,979,601	S161P	probably benign	Het
Ceacam19	T	C	7: 19,882,887	I161V	probably benign	Het
Cfap65	A	G	1: 74,920,405	I862T	probably damaging	Het
Cfi	T	A	3: 129,858,370	L230Q	probably benign	Het
Chac2	G	A	11: 30,986,159	R30W	probably damaging	Het
Cmc2	G	A	8: 116,889,827		probably benign	Het
Col1a2	A	T	6: 4,505,840	M1L	probably benign	Het
Cox8a	C	A	19: 7,217,418	R32L	possibly damaging	Het
Cubn	T	A	2: 13,430,897	N1083Y	probably damaging	Het
D430042O09Rik	G	A	7: 125,814,865	G394R	probably benign	Het
D630003M21Rik	T	C	2: 158,217,584	D132G	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dnaaf3	T	C	7: 4,524,213	D358G	probably benign	Het
Dysf	T	A	6: 84,019,604	F29L	probably damaging	Het
Dysf	T	C	6: 84,112,119	L888P	probably damaging	Het
Ebf4	A	G	2: 130,309,723	D277G	probably damaging	Het
Ecm2	T	A	13: 49,515,094	L91*	probably null	Het
Foxs1	T	C	2: 152,932,842	D97G	possibly damaging	Het
Frs2	A	C	10: 117,076,809		probably null	Het
Gm6768	A	G	12: 119,261,651		noncoding transcript	Het
Grp	A	T	18: 65,879,937	D58V	probably damaging	Het
Hif1a	T	G	12: 73,941,842	F537C	probably damaging	Het
Icam4	G	A	9: 21,029,539	S29N	probably benign	Het
Itfg1	T	C	8: 85,726,170	E523G	probably benign	Het
Kcnq2	A	T	2: 181,087,656	V490E	possibly damaging	Het
Klhl18	C	T	9: 110,428,727	M548I	possibly damaging	Het
Lpin3	A	G	2: 160,895,801	Y197C	probably benign	Het
Lrp1	T	C	10: 127,560,553	N2381D	probably benign	Het
Man1a	A	T	10: 53,919,211	W649R	probably damaging	Het
Map4	T	C	9: 110,064,292	L542P	probably damaging	Het
Mboat2	A	T	12: 24,878,285	H52L	probably damaging	Het
Mok	C	G	12: 110,814,946	S91T	probably benign	Het
Mtmr11	G	T	3: 96,168,084	R360L	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Olfr1288	A	T	2: 111,479,389	N202Y	probably damaging	Het
Olfr341	A	G	2: 36,479,512	V206A	probably benign	Het
Olfr544	T	C	7: 102,484,389	T244A	probably damaging	Het
Olfr67	C	T	7: 103,787,955	M107I	probably benign	Het
Olfr836	A	G	9: 19,121,327	D121G	probably damaging	Het
Olfr867	A	T	9: 20,054,883	H75Q	possibly damaging	Het
Padi3	G	T	4: 140,795,843	T292N	probably damaging	Het
Pard6g	A	C	18: 80,117,205	T178P	possibly damaging	Het
Pkd1l2	A	T	8: 117,013,987	Y2124N	probably damaging	Het
Plxdc1	G	A	11: 97,928,463	T398I	probably damaging	Het
Prickle2	A	T	6: 92,416,848	C225*	probably null	Het
Prmt2	G	A	10: 76,210,444	T317I	probably benign	Het
Psg22	T	G	7: 18,719,780	N172K	probably benign	Het
Ptpn9	C	T	9: 57,033,163	R196*	probably null	Het
Rap1b	C	T	10: 117,824,611	V14I	probably damaging	Het
Rapgef4	T	A	2: 72,196,278		probably null	Het
Rlf	A	T	4: 121,149,215	M856K	possibly damaging	Het
Rnf149	A	G	1: 39,577,174	L34P	probably benign	Het
Rock1	T	C	18: 10,101,007	E636G	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Ryr3	T	C	2: 112,908,493	H563R	probably damaging	Het
Slc18b1	A	G	10: 23,804,212	M102V	probably benign	Het
Slc34a2	T	A	5: 53,067,647	C377S	possibly damaging	Het
Slco1c1	T	C	6: 141,546,770	V293A	probably benign	Het
Spidr	A	T	16: 16,140,024	S80T	possibly damaging	Het
Syne1	C	T	10: 5,348,994	E1031K	probably damaging	Het
Synj2	G	A	17: 6,017,614	V121I	probably damaging	Het
Synj2	A	T	17: 6,038,098	T1430S	probably damaging	Het
Tecpr2	G	T	12: 110,929,109	K343N	probably damaging	Het
Tmem132d	T	A	5: 127,784,100	I986F	probably benign	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Ttll10	T	A	4: 156,045,357	D283V	probably benign	Het
Ttn	T	A	2: 76,814,779	K673*	probably null	Het
Ubqlnl	T	A	7: 104,148,698	M531L	probably benign	Het
Vmn2r120	A	T	17: 57,525,721	W153R	probably benign	Het
Vmn2r2	A	C	3: 64,117,046	S705A	probably benign	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r54	T	A	7: 12,632,278	Q243L	probably damaging	Het
Wdr24	C	A	17: 25,824,530	R109S	probably damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp426	G	T	9: 20,470,627	Q341K	possibly damaging	Het
Zfp616	A	T	11: 74,083,846	K314*	probably null	Het

Other mutations in Jph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Jph2	APN	2	163339927	missense	probably benign	0.07
IGL02314:Jph2	APN	2	163397353	missense	probably damaging	1.00
IGL02565:Jph2	APN	2	163397345	missense	probably damaging	1.00
IGL02593:Jph2	APN	2	163397246	missense	probably damaging	1.00
IGL02713:Jph2	APN	2	163375917	missense	probably damaging	1.00
IGL02742:Jph2	APN	2	163375779	missense	probably damaging	1.00
R1479:Jph2	UTSW	2	163339271	missense	possibly damaging	0.62
R2069:Jph2	UTSW	2	163339685	missense	possibly damaging	0.81
R3848:Jph2	UTSW	2	163339412	missense	probably benign	0.22
R4961:Jph2	UTSW	2	163375748	missense	probably damaging	1.00
R6377:Jph2	UTSW	2	163339712	missense	probably benign
R6667:Jph2	UTSW	2	163376286	missense	probably damaging	1.00
R6874:Jph2	UTSW	2	163339487	missense	probably benign	0.24
R7112:Jph2	UTSW	2	163375784	missense	probably damaging	1.00
R7874:Jph2	UTSW	2	163375842	missense	probably damaging	1.00
R8109:Jph2	UTSW	2	163339286	missense	probably benign	0.00
R8196:Jph2	UTSW	2	163338701	critical splice acceptor site	probably null
R8802:Jph2	UTSW	2	163397264	missense	probably damaging	1.00
R9098:Jph2	UTSW	2	163339553	missense	probably damaging	1.00
R9228:Jph2	UTSW	2	163338686	missense	probably benign	0.11
R9274:Jph2	UTSW	2	163397627	start gained	probably benign
Z1088:Jph2	UTSW	2	163397332	missense	possibly damaging	0.94
Z1177:Jph2	UTSW	2	163376377	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGATGCATGGGTGACTCTC -3'
(R):5'- ACCACGGAAACCTACATGGG -3'

Posted On

2017-07-14