Incidental Mutation 'R6084:Cc2d2a'
ID 482370
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 044243-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R6084 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43826015 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably benign
Transcript: ENSMUST00000048150
AA Change: N2K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: N2K

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,828,297 (GRCm39) D958G possibly damaging Het
Bag4 T C 8: 26,261,259 (GRCm39) T161A probably benign Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Cacna2d2 T C 9: 107,374,720 (GRCm39) probably null Het
Cass4 G T 2: 172,268,832 (GRCm39) A307S probably benign Het
Cbln4 A T 2: 171,884,016 (GRCm39) V68E probably damaging Het
Ccnf T A 17: 24,450,811 (GRCm39) D389V probably damaging Het
Cdipt T C 7: 126,578,773 (GRCm39) S161P probably benign Het
Ceacam19 T C 7: 19,616,812 (GRCm39) I161V probably benign Het
Cfap65 A G 1: 74,959,564 (GRCm39) I862T probably damaging Het
Cfi T A 3: 129,652,019 (GRCm39) L230Q probably benign Het
Chac2 G A 11: 30,936,159 (GRCm39) R30W probably damaging Het
Cmc2 G A 8: 117,616,566 (GRCm39) probably benign Het
Col1a2 A T 6: 4,505,840 (GRCm39) M1L probably benign Het
Cox8a C A 19: 7,194,783 (GRCm39) R32L possibly damaging Het
Cubn T A 2: 13,435,708 (GRCm39) N1083Y probably damaging Het
D630003M21Rik T C 2: 158,059,504 (GRCm39) D132G probably damaging Het
Dedd2 G A 7: 24,910,715 (GRCm39) P154S probably benign Het
Dnaaf3 T C 7: 4,527,212 (GRCm39) D358G probably benign Het
Dysf T C 6: 84,089,101 (GRCm39) L888P probably damaging Het
Dysf T A 6: 83,996,586 (GRCm39) F29L probably damaging Het
Ebf4 A G 2: 130,151,643 (GRCm39) D277G probably damaging Het
Ecm2 T A 13: 49,668,570 (GRCm39) L91* probably null Het
Foxs1 T C 2: 152,774,762 (GRCm39) D97G possibly damaging Het
Frs2 A C 10: 116,912,714 (GRCm39) probably null Het
Grp A T 18: 66,013,008 (GRCm39) D58V probably damaging Het
Hif1a T G 12: 73,988,616 (GRCm39) F537C probably damaging Het
Icam4 G A 9: 20,940,835 (GRCm39) S29N probably benign Het
Itfg1 T C 8: 86,452,799 (GRCm39) E523G probably benign Het
Jph2 T C 2: 163,217,600 (GRCm39) K359E probably damaging Het
Katnip G A 7: 125,414,037 (GRCm39) G394R probably benign Het
Kcnq2 A T 2: 180,729,449 (GRCm39) V490E possibly damaging Het
Klhl18 C T 9: 110,257,795 (GRCm39) M548I possibly damaging Het
Lpin3 A G 2: 160,737,721 (GRCm39) Y197C probably benign Het
Lrp1 T C 10: 127,396,422 (GRCm39) N2381D probably benign Het
Man1a A T 10: 53,795,307 (GRCm39) W649R probably damaging Het
Map4 T C 9: 109,893,360 (GRCm39) L542P probably damaging Het
Mboat2 A T 12: 24,928,284 (GRCm39) H52L probably damaging Het
Mok C G 12: 110,781,380 (GRCm39) S91T probably benign Het
Mtmr11 G T 3: 96,075,400 (GRCm39) R360L probably damaging Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Ncoa4-ps A G 12: 119,225,386 (GRCm39) noncoding transcript Het
Or1j13 A G 2: 36,369,524 (GRCm39) V206A probably benign Het
Or4g7 A T 2: 111,309,734 (GRCm39) N202Y probably damaging Het
Or52z1 C T 7: 103,437,162 (GRCm39) M107I probably benign Het
Or55b4 T C 7: 102,133,596 (GRCm39) T244A probably damaging Het
Or7d11 A T 9: 19,966,179 (GRCm39) H75Q possibly damaging Het
Or7g21 A G 9: 19,032,623 (GRCm39) D121G probably damaging Het
Padi3 G T 4: 140,523,154 (GRCm39) T292N probably damaging Het
Pard6g A C 18: 80,160,420 (GRCm39) T178P possibly damaging Het
Pkd1l2 A T 8: 117,740,726 (GRCm39) Y2124N probably damaging Het
Plxdc1 G A 11: 97,819,289 (GRCm39) T398I probably damaging Het
Prickle2 A T 6: 92,393,829 (GRCm39) C225* probably null Het
Prmt2 G A 10: 76,046,278 (GRCm39) T317I probably benign Het
Psg22 T G 7: 18,453,705 (GRCm39) N172K probably benign Het
Ptpn9 C T 9: 56,940,447 (GRCm39) R196* probably null Het
Rap1b C T 10: 117,660,516 (GRCm39) V14I probably damaging Het
Rapgef4 T A 2: 72,026,622 (GRCm39) probably null Het
Rlf A T 4: 121,006,412 (GRCm39) M856K possibly damaging Het
Rnf149 A G 1: 39,616,255 (GRCm39) L34P probably benign Het
Rock1 T C 18: 10,101,007 (GRCm39) E636G probably benign Het
Rsad2 A T 12: 26,504,122 (GRCm39) Y136N probably damaging Het
Ryr3 T C 2: 112,738,838 (GRCm39) H563R probably damaging Het
Slc18b1 A G 10: 23,680,110 (GRCm39) M102V probably benign Het
Slc34a2 T A 5: 53,224,989 (GRCm39) C377S possibly damaging Het
Slco1c1 T C 6: 141,492,496 (GRCm39) V293A probably benign Het
Spidr A T 16: 15,957,888 (GRCm39) S80T possibly damaging Het
Syne1 C T 10: 5,298,994 (GRCm39) E1031K probably damaging Het
Synj2 G A 17: 6,067,889 (GRCm39) V121I probably damaging Het
Synj2 A T 17: 6,088,373 (GRCm39) T1430S probably damaging Het
Tecpr2 G T 12: 110,895,543 (GRCm39) K343N probably damaging Het
Tmem132d T A 5: 127,861,164 (GRCm39) I986F probably benign Het
Trib1 G A 15: 59,526,324 (GRCm39) R298H probably damaging Het
Ttll10 T A 4: 156,129,814 (GRCm39) D283V probably benign Het
Ttn T A 2: 76,645,123 (GRCm39) K673* probably null Het
Ubqlnl T A 7: 103,797,905 (GRCm39) M531L probably benign Het
Vmn2r120 A T 17: 57,832,721 (GRCm39) W153R probably benign Het
Vmn2r2 A C 3: 64,024,467 (GRCm39) S705A probably benign Het
Vmn2r32 T A 7: 7,467,209 (GRCm39) D773V probably benign Het
Vmn2r54 T A 7: 12,366,205 (GRCm39) Q243L probably damaging Het
Wdr24 C A 17: 26,043,504 (GRCm39) R109S probably damaging Het
Zfp113 T C 5: 138,143,930 (GRCm39) M107V probably benign Het
Zfp426 G T 9: 20,381,923 (GRCm39) Q341K possibly damaging Het
Zfp616 A T 11: 73,974,672 (GRCm39) K314* probably null Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43,887,317 (GRCm39) missense probably damaging 1.00
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTCTGGCTGAGGTTCATCTG -3'
(R):5'- ACCTGCCACTGTCTGATTGTG -3'

Posted On 2017-07-14