Mutagenetix > Incidental Mutations

Incidental Mutation 'R6084:Slc34a2'

482371

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

044243-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6084 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53067647 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 377 (C377S)

Ref Sequence

ENSEMBL: ENSMUSP00000092380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094787
AA Change: C377S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: C377S

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	T	C	5: 62,670,954	D958G	possibly damaging	Het
Bag4	T	C	8: 25,771,231	T161A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cacna2d2	T	C	9: 107,497,521		probably null	Het
Cass4	G	T	2: 172,426,912	A307S	probably benign	Het
Cbln4	A	T	2: 172,042,096	V68E	probably damaging	Het
Cc2d2a	T	A	5: 43,668,673	N2K	probably benign	Het
Ccnf	T	A	17: 24,231,837	D389V	probably damaging	Het
Cdipt	T	C	7: 126,979,601	S161P	probably benign	Het
Ceacam19	T	C	7: 19,882,887	I161V	probably benign	Het
Cfap65	A	G	1: 74,920,405	I862T	probably damaging	Het
Cfi	T	A	3: 129,858,370	L230Q	probably benign	Het
Chac2	G	A	11: 30,986,159	R30W	probably damaging	Het
Cmc2	G	A	8: 116,889,827		probably benign	Het
Col1a2	A	T	6: 4,505,840	M1L	probably benign	Het
Cox8a	C	A	19: 7,217,418	R32L	possibly damaging	Het
Cubn	T	A	2: 13,430,897	N1083Y	probably damaging	Het
D430042O09Rik	G	A	7: 125,814,865	G394R	probably benign	Het
D630003M21Rik	T	C	2: 158,217,584	D132G	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dnaaf3	T	C	7: 4,524,213	D358G	probably benign	Het
Dysf	T	A	6: 84,019,604	F29L	probably damaging	Het
Dysf	T	C	6: 84,112,119	L888P	probably damaging	Het
Ebf4	A	G	2: 130,309,723	D277G	probably damaging	Het
Ecm2	T	A	13: 49,515,094	L91*	probably null	Het
Foxs1	T	C	2: 152,932,842	D97G	possibly damaging	Het
Frs2	A	C	10: 117,076,809		probably null	Het
Gm6768	A	G	12: 119,261,651		noncoding transcript	Het
Grp	A	T	18: 65,879,937	D58V	probably damaging	Het
Hif1a	T	G	12: 73,941,842	F537C	probably damaging	Het
Icam4	G	A	9: 21,029,539	S29N	probably benign	Het
Itfg1	T	C	8: 85,726,170	E523G	probably benign	Het
Jph2	T	C	2: 163,375,680	K359E	probably damaging	Het
Kcnq2	A	T	2: 181,087,656	V490E	possibly damaging	Het
Klhl18	C	T	9: 110,428,727	M548I	possibly damaging	Het
Lpin3	A	G	2: 160,895,801	Y197C	probably benign	Het
Lrp1	T	C	10: 127,560,553	N2381D	probably benign	Het
Man1a	A	T	10: 53,919,211	W649R	probably damaging	Het
Map4	T	C	9: 110,064,292	L542P	probably damaging	Het
Mboat2	A	T	12: 24,878,285	H52L	probably damaging	Het
Mok	C	G	12: 110,814,946	S91T	probably benign	Het
Mtmr11	G	T	3: 96,168,084	R360L	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Olfr1288	A	T	2: 111,479,389	N202Y	probably damaging	Het
Olfr341	A	G	2: 36,479,512	V206A	probably benign	Het
Olfr544	T	C	7: 102,484,389	T244A	probably damaging	Het
Olfr67	C	T	7: 103,787,955	M107I	probably benign	Het
Olfr836	A	G	9: 19,121,327	D121G	probably damaging	Het
Olfr867	A	T	9: 20,054,883	H75Q	possibly damaging	Het
Padi3	G	T	4: 140,795,843	T292N	probably damaging	Het
Pard6g	A	C	18: 80,117,205	T178P	possibly damaging	Het
Pkd1l2	A	T	8: 117,013,987	Y2124N	probably damaging	Het
Plxdc1	G	A	11: 97,928,463	T398I	probably damaging	Het
Prickle2	A	T	6: 92,416,848	C225*	probably null	Het
Prmt2	G	A	10: 76,210,444	T317I	probably benign	Het
Psg22	T	G	7: 18,719,780	N172K	probably benign	Het
Ptpn9	C	T	9: 57,033,163	R196*	probably null	Het
Rap1b	C	T	10: 117,824,611	V14I	probably damaging	Het
Rapgef4	T	A	2: 72,196,278		probably null	Het
Rlf	A	T	4: 121,149,215	M856K	possibly damaging	Het
Rnf149	A	G	1: 39,577,174	L34P	probably benign	Het
Rock1	T	C	18: 10,101,007	E636G	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Ryr3	T	C	2: 112,908,493	H563R	probably damaging	Het
Slc18b1	A	G	10: 23,804,212	M102V	probably benign	Het
Slco1c1	T	C	6: 141,546,770	V293A	probably benign	Het
Spidr	A	T	16: 16,140,024	S80T	possibly damaging	Het
Syne1	C	T	10: 5,348,994	E1031K	probably damaging	Het
Synj2	G	A	17: 6,017,614	V121I	probably damaging	Het
Synj2	A	T	17: 6,038,098	T1430S	probably damaging	Het
Tecpr2	G	T	12: 110,929,109	K343N	probably damaging	Het
Tmem132d	T	A	5: 127,784,100	I986F	probably benign	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Ttll10	T	A	4: 156,045,357	D283V	probably benign	Het
Ttn	T	A	2: 76,814,779	K673*	probably null	Het
Ubqlnl	T	A	7: 104,148,698	M531L	probably benign	Het
Vmn2r120	A	T	17: 57,525,721	W153R	probably benign	Het
Vmn2r2	A	C	3: 64,117,046	S705A	probably benign	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r54	T	A	7: 12,632,278	Q243L	probably damaging	Het
Wdr24	C	A	17: 25,824,530	R109S	probably damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp426	G	T	9: 20,470,627	Q341K	possibly damaging	Het
Zfp616	A	T	11: 74,083,846	K314*	probably null	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5313:Slc34a2	UTSW	5	53069339	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R7956:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
Z1176:Slc34a2	UTSW	5	53060817	missense	not run

Predicted Primers

PCR Primer
(F):5'- TCTAGCTGCCAGGCAAGATTG -3'
(R):5'- GGCCCATGGTTCTGACAAAC -3'

Posted On

2017-07-14