Incidental Mutation 'R6084:D430042O09Rik'
ID482389
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125814865 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 394 (G394R)
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect probably benign
Transcript: ENSMUST00000069660
AA Change: G420R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: G420R

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122337
SMART Domains Protein: ENSMUSP00000113734
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 173 344 2.7e-9 PFAM
Pfam:DUF4457 218 394 3.2e-10 PFAM
low complexity region 444 458 N/A INTRINSIC
Pfam:DUF4457 660 742 1.1e-14 PFAM
Pfam:DUF4457 733 863 2.6e-31 PFAM
Pfam:DUF4457 944 1008 5.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124223
AA Change: G394R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: G394R

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 splice site probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2008:D430042O09Rik UTSW 7 125860566 missense probably damaging 1.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
R7584:D430042O09Rik UTSW 7 125870666 missense probably damaging 0.99
R7629:D430042O09Rik UTSW 7 125795250 missense probably damaging 0.96
R7676:D430042O09Rik UTSW 7 125850377 missense probably benign 0.26
R7748:D430042O09Rik UTSW 7 125829801 missense probably benign 0.00
R7786:D430042O09Rik UTSW 7 125865294 missense probably benign 0.19
R8058:D430042O09Rik UTSW 7 125843016 missense probably benign 0.17
R8154:D430042O09Rik UTSW 7 125813630 missense probably damaging 0.98
R8204:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R8359:D430042O09Rik UTSW 7 125868851 critical splice donor site probably null
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCCATGCTTTGACCATTGC -3'
(R):5'- TGGTTAGCTTGCCTGACTC -3'

Posted On2017-07-14