Mutagenetix > Incidental Mutations

Incidental Mutation 'R6084:Pkd1l2'

482394

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l2

Ensembl Gene

ENSMUSG00000034416

Gene Name

polycystic kidney disease 1 like 2

Synonyms

MMRRC Submission

044243-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6084 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116995679-117082449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117013987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 2124 (Y2124N)

Ref Sequence

ENSEMBL: ENSMUSP00000104721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000098375
AA Change: Y2123N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: Y2123N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	1.8e-18	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	510	886	1.8e-13	PFAM
low complexity region	1050	1060	N/A	INTRINSIC
GPS	1278	1327	1.61e-11	SMART
transmembrane domain	1346	1365	N/A	INTRINSIC
LH2	1390	1509	6.05e-13	SMART
transmembrane domain	1552	1574	N/A	INTRINSIC
transmembrane domain	1589	1611	N/A	INTRINSIC
transmembrane domain	1815	1837	N/A	INTRINSIC
transmembrane domain	1852	1874	N/A	INTRINSIC
transmembrane domain	1940	1962	N/A	INTRINSIC
Pfam:PKD_channel	1980	2403	6.4e-107	PFAM
Pfam:Ion_trans	2187	2396	2.5e-12	PFAM
low complexity region	2441	2458	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109093
AA Change: Y2124N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: Y2124N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	6.9e-19	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	519	883	7e-11	PFAM
low complexity region	1051	1061	N/A	INTRINSIC
GPS	1279	1328	1.61e-11	SMART
transmembrane domain	1347	1366	N/A	INTRINSIC
LH2	1391	1510	6.05e-13	SMART
transmembrane domain	1553	1575	N/A	INTRINSIC
transmembrane domain	1590	1612	N/A	INTRINSIC
transmembrane domain	1816	1838	N/A	INTRINSIC
transmembrane domain	1853	1875	N/A	INTRINSIC
transmembrane domain	1941	1963	N/A	INTRINSIC
Pfam:PKD_channel	1981	2403	5.9e-106	PFAM
Pfam:Ion_trans	2138	2409	3.4e-12	PFAM
low complexity region	2442	2459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162080

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	T	C	5: 62,670,954	D958G	possibly damaging	Het
Bag4	T	C	8: 25,771,231	T161A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cacna2d2	T	C	9: 107,497,521		probably null	Het
Cass4	G	T	2: 172,426,912	A307S	probably benign	Het
Cbln4	A	T	2: 172,042,096	V68E	probably damaging	Het
Cc2d2a	T	A	5: 43,668,673	N2K	probably benign	Het
Ccnf	T	A	17: 24,231,837	D389V	probably damaging	Het
Cdipt	T	C	7: 126,979,601	S161P	probably benign	Het
Ceacam19	T	C	7: 19,882,887	I161V	probably benign	Het
Cfap65	A	G	1: 74,920,405	I862T	probably damaging	Het
Cfi	T	A	3: 129,858,370	L230Q	probably benign	Het
Chac2	G	A	11: 30,986,159	R30W	probably damaging	Het
Cmc2	G	A	8: 116,889,827		probably benign	Het
Col1a2	A	T	6: 4,505,840	M1L	probably benign	Het
Cox8a	C	A	19: 7,217,418	R32L	possibly damaging	Het
Cubn	T	A	2: 13,430,897	N1083Y	probably damaging	Het
D430042O09Rik	G	A	7: 125,814,865	G394R	probably benign	Het
D630003M21Rik	T	C	2: 158,217,584	D132G	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Dnaaf3	T	C	7: 4,524,213	D358G	probably benign	Het
Dysf	T	A	6: 84,019,604	F29L	probably damaging	Het
Dysf	T	C	6: 84,112,119	L888P	probably damaging	Het
Ebf4	A	G	2: 130,309,723	D277G	probably damaging	Het
Ecm2	T	A	13: 49,515,094	L91*	probably null	Het
Foxs1	T	C	2: 152,932,842	D97G	possibly damaging	Het
Frs2	A	C	10: 117,076,809		probably null	Het
Gm6768	A	G	12: 119,261,651		noncoding transcript	Het
Grp	A	T	18: 65,879,937	D58V	probably damaging	Het
Hif1a	T	G	12: 73,941,842	F537C	probably damaging	Het
Icam4	G	A	9: 21,029,539	S29N	probably benign	Het
Itfg1	T	C	8: 85,726,170	E523G	probably benign	Het
Jph2	T	C	2: 163,375,680	K359E	probably damaging	Het
Kcnq2	A	T	2: 181,087,656	V490E	possibly damaging	Het
Klhl18	C	T	9: 110,428,727	M548I	possibly damaging	Het
Lpin3	A	G	2: 160,895,801	Y197C	probably benign	Het
Lrp1	T	C	10: 127,560,553	N2381D	probably benign	Het
Man1a	A	T	10: 53,919,211	W649R	probably damaging	Het
Map4	T	C	9: 110,064,292	L542P	probably damaging	Het
Mboat2	A	T	12: 24,878,285	H52L	probably damaging	Het
Mok	C	G	12: 110,814,946	S91T	probably benign	Het
Mtmr11	G	T	3: 96,168,084	R360L	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Olfr1288	A	T	2: 111,479,389	N202Y	probably damaging	Het
Olfr341	A	G	2: 36,479,512	V206A	probably benign	Het
Olfr544	T	C	7: 102,484,389	T244A	probably damaging	Het
Olfr67	C	T	7: 103,787,955	M107I	probably benign	Het
Olfr836	A	G	9: 19,121,327	D121G	probably damaging	Het
Olfr867	A	T	9: 20,054,883	H75Q	possibly damaging	Het
Padi3	G	T	4: 140,795,843	T292N	probably damaging	Het
Pard6g	A	C	18: 80,117,205	T178P	possibly damaging	Het
Plxdc1	G	A	11: 97,928,463	T398I	probably damaging	Het
Prickle2	A	T	6: 92,416,848	C225*	probably null	Het
Prmt2	G	A	10: 76,210,444	T317I	probably benign	Het
Psg22	T	G	7: 18,719,780	N172K	probably benign	Het
Ptpn9	C	T	9: 57,033,163	R196*	probably null	Het
Rap1b	C	T	10: 117,824,611	V14I	probably damaging	Het
Rapgef4	T	A	2: 72,196,278		probably null	Het
Rlf	A	T	4: 121,149,215	M856K	possibly damaging	Het
Rnf149	A	G	1: 39,577,174	L34P	probably benign	Het
Rock1	T	C	18: 10,101,007	E636G	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Ryr3	T	C	2: 112,908,493	H563R	probably damaging	Het
Slc18b1	A	G	10: 23,804,212	M102V	probably benign	Het
Slc34a2	T	A	5: 53,067,647	C377S	possibly damaging	Het
Slco1c1	T	C	6: 141,546,770	V293A	probably benign	Het
Spidr	A	T	16: 16,140,024	S80T	possibly damaging	Het
Syne1	C	T	10: 5,348,994	E1031K	probably damaging	Het
Synj2	G	A	17: 6,017,614	V121I	probably damaging	Het
Synj2	A	T	17: 6,038,098	T1430S	probably damaging	Het
Tecpr2	G	T	12: 110,929,109	K343N	probably damaging	Het
Tmem132d	T	A	5: 127,784,100	I986F	probably benign	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Ttll10	T	A	4: 156,045,357	D283V	probably benign	Het
Ttn	T	A	2: 76,814,779	K673*	probably null	Het
Ubqlnl	T	A	7: 104,148,698	M531L	probably benign	Het
Vmn2r120	A	T	17: 57,525,721	W153R	probably benign	Het
Vmn2r2	A	C	3: 64,117,046	S705A	probably benign	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r54	T	A	7: 12,632,278	Q243L	probably damaging	Het
Wdr24	C	A	17: 25,824,530	R109S	probably damaging	Het
Zfp113	T	C	5: 138,145,668	M107V	probably benign	Het
Zfp426	G	T	9: 20,470,627	Q341K	possibly damaging	Het
Zfp616	A	T	11: 74,083,846	K314*	probably null	Het

Other mutations in Pkd1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Pkd1l2	APN	8	117059520	nonsense	probably null
IGL01353:Pkd1l2	APN	8	117057443	missense	probably benign	0.24
IGL01362:Pkd1l2	APN	8	117021856	missense	probably damaging	1.00
IGL01486:Pkd1l2	APN	8	117059592	missense	probably benign
IGL01672:Pkd1l2	APN	8	117080732	missense	possibly damaging	0.94
IGL01696:Pkd1l2	APN	8	117056387	missense	probably benign	0.12
IGL01819:Pkd1l2	APN	8	116998174	missense	probably damaging	1.00
IGL01833:Pkd1l2	APN	8	117060525	missense	probably benign	0.00
IGL01981:Pkd1l2	APN	8	117016916	missense	probably benign	0.04
IGL02066:Pkd1l2	APN	8	117009564	splice site	probably benign
IGL02381:Pkd1l2	APN	8	117035800	splice site	probably benign
IGL02416:Pkd1l2	APN	8	117040835	missense	possibly damaging	0.82
IGL02736:Pkd1l2	APN	8	117040666	missense	probably benign	0.00
IGL02828:Pkd1l2	APN	8	117029559	missense	probably benign
IGL02861:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02862:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02883:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02884:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02894:Pkd1l2	APN	8	117013891	missense	probably damaging	0.97
IGL02900:Pkd1l2	APN	8	117024091	missense	probably benign	0.03
IGL02901:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02929:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02941:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02957:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02969:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03028:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03059:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03065:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03066:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03083:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03084:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03124:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03162:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03165:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03335:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03357:Pkd1l2	APN	8	116995809	missense	probably damaging	1.00
IGL02835:Pkd1l2	UTSW	8	117065745	missense	probably benign	0.07
PIT4453001:Pkd1l2	UTSW	8	117022022	missense	probably benign	0.00
R0127:Pkd1l2	UTSW	8	117050048	splice site	probably benign
R0309:Pkd1l2	UTSW	8	116997576	missense	probably damaging	0.99
R0365:Pkd1l2	UTSW	8	117021850	missense	probably benign	0.02
R0526:Pkd1l2	UTSW	8	117082260	missense	probably damaging	1.00
R0571:Pkd1l2	UTSW	8	117082218	missense	probably benign	0.01
R0716:Pkd1l2	UTSW	8	117051100	missense	probably damaging	1.00
R0787:Pkd1l2	UTSW	8	117076177	missense	possibly damaging	0.90
R0893:Pkd1l2	UTSW	8	117044492	missense	probably damaging	0.99
R1256:Pkd1l2	UTSW	8	117019543	critical splice acceptor site	probably null
R1391:Pkd1l2	UTSW	8	117054934	missense	possibly damaging	0.87
R1474:Pkd1l2	UTSW	8	117065497	splice site	probably benign
R1491:Pkd1l2	UTSW	8	117028408	missense	probably damaging	1.00
R1520:Pkd1l2	UTSW	8	117046159	missense	probably benign	0.00
R1521:Pkd1l2	UTSW	8	117065500	splice site	probably null
R1544:Pkd1l2	UTSW	8	117038235	frame shift	probably null
R1558:Pkd1l2	UTSW	8	117082252	missense	possibly damaging	0.94
R1673:Pkd1l2	UTSW	8	117040775	missense	probably benign	0.00
R1691:Pkd1l2	UTSW	8	117056419	missense	possibly damaging	0.60
R1754:Pkd1l2	UTSW	8	117030719	missense	possibly damaging	0.81
R1857:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R1939:Pkd1l2	UTSW	8	117046182	nonsense	probably null
R1955:Pkd1l2	UTSW	8	117043361	missense	probably benign
R1957:Pkd1l2	UTSW	8	117030682	missense	probably damaging	1.00
R1959:Pkd1l2	UTSW	8	117043231	critical splice donor site	probably null
R2024:Pkd1l2	UTSW	8	117019533	missense	probably benign
R2046:Pkd1l2	UTSW	8	116999955	missense	probably damaging	1.00
R2102:Pkd1l2	UTSW	8	117081469	missense	probably damaging	0.98
R2116:Pkd1l2	UTSW	8	117030722	missense	possibly damaging	0.93
R2148:Pkd1l2	UTSW	8	117056325	missense	probably damaging	0.98
R2251:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2252:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2366:Pkd1l2	UTSW	8	117043317	missense	probably benign	0.01
R2566:Pkd1l2	UTSW	8	117019494	missense	probably damaging	1.00
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2985:Pkd1l2	UTSW	8	117065551	missense	probably benign	0.00
R3055:Pkd1l2	UTSW	8	117068315	critical splice acceptor site	probably null
R3436:Pkd1l2	UTSW	8	117040739	missense	probably benign	0.01
R4732:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4733:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4763:Pkd1l2	UTSW	8	117019429	missense	probably damaging	0.96
R4789:Pkd1l2	UTSW	8	117011575	missense	probably damaging	0.99
R4921:Pkd1l2	UTSW	8	117054885	missense	probably benign	0.03
R4921:Pkd1l2	UTSW	8	117072549	missense	probably damaging	0.97
R4999:Pkd1l2	UTSW	8	117047374	splice site	probably null
R5057:Pkd1l2	UTSW	8	117055008	missense	probably benign	0.21
R5209:Pkd1l2	UTSW	8	117056442	missense	probably benign	0.23
R5241:Pkd1l2	UTSW	8	117035118	missense	probably damaging	1.00
R5480:Pkd1l2	UTSW	8	117030649	missense	probably damaging	0.99
R5501:Pkd1l2	UTSW	8	117065830	missense	probably damaging	0.98
R5533:Pkd1l2	UTSW	8	117068116	missense	probably benign	0.03
R5582:Pkd1l2	UTSW	8	117040783	nonsense	probably null
R5610:Pkd1l2	UTSW	8	117042320	missense	probably benign	0.04
R5770:Pkd1l2	UTSW	8	117055018	missense	probably damaging	1.00
R5854:Pkd1l2	UTSW	8	117065746	missense	possibly damaging	0.48
R5867:Pkd1l2	UTSW	8	117055011	missense	probably damaging	0.96
R5881:Pkd1l2	UTSW	8	116997582	missense	probably damaging	0.99
R5906:Pkd1l2	UTSW	8	117029648	missense	probably damaging	1.00
R5909:Pkd1l2	UTSW	8	117024056	missense	probably benign	0.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6122:Pkd1l2	UTSW	8	117082368	missense	probably benign	0.02
R6216:Pkd1l2	UTSW	8	117081470	missense	probably damaging	1.00
R6406:Pkd1l2	UTSW	8	117035847	missense	probably damaging	0.99
R6417:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6420:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6601:Pkd1l2	UTSW	8	117040666	missense	probably benign	0.00
R6743:Pkd1l2	UTSW	8	117030631	missense	probably damaging	1.00
R7053:Pkd1l2	UTSW	8	117013942	missense	probably damaging	1.00
R7144:Pkd1l2	UTSW	8	117076131	nonsense	probably null
R7148:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7169:Pkd1l2	UTSW	8	117040835	missense	possibly damaging	0.82
R7217:Pkd1l2	UTSW	8	116995797	missense	probably benign	0.24
R7310:Pkd1l2	UTSW	8	117024034	missense	probably benign
R7382:Pkd1l2	UTSW	8	117054871	missense	possibly damaging	0.95
R7397:Pkd1l2	UTSW	8	117035902	missense	possibly damaging	0.94
R7408:Pkd1l2	UTSW	8	117028479	missense	possibly damaging	0.77
R7437:Pkd1l2	UTSW	8	117030682	missense	probably damaging	0.96
R7492:Pkd1l2	UTSW	8	117068110	missense	probably damaging	1.00
R7496:Pkd1l2	UTSW	8	117060594	missense	possibly damaging	0.89
R7519:Pkd1l2	UTSW	8	117065529	missense	probably benign
R7590:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7623:Pkd1l2	UTSW	8	117029645	missense	probably damaging	1.00
R7768:Pkd1l2	UTSW	8	117054860	critical splice donor site	probably null
R7897:Pkd1l2	UTSW	8	116998088	missense	possibly damaging	0.69
R7982:Pkd1l2	UTSW	8	117051187	missense	possibly damaging	0.70
R8024:Pkd1l2	UTSW	8	117076182	missense	possibly damaging	0.85
R8140:Pkd1l2	UTSW	8	117047497	missense	probably benign
R8145:Pkd1l2	UTSW	8	117055003	missense	probably benign
R8228:Pkd1l2	UTSW	8	117065775	missense	probably damaging	0.97
R8252:Pkd1l2	UTSW	8	117040733	missense	probably benign	0.29
R8500:Pkd1l2	UTSW	8	117047563	critical splice acceptor site	probably null
R8732:Pkd1l2	UTSW	8	117065572	missense	probably benign	0.28
R8809:Pkd1l2	UTSW	8	116999921	missense	probably damaging	1.00
R8896:Pkd1l2	UTSW	8	117013876	missense	possibly damaging	0.91
R8961:Pkd1l2	UTSW	8	116999978	missense	possibly damaging	0.52
R8985:Pkd1l2	UTSW	8	117038110	missense	probably benign	0.01
R9008:Pkd1l2	UTSW	8	117042298	missense	probably benign	0.32
R9091:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
R9138:Pkd1l2	UTSW	8	117055009	missense	probably benign	0.43
R9160:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R9249:Pkd1l2	UTSW	8	117019420	missense	probably damaging	0.99
R9270:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
Z1176:Pkd1l2	UTSW	8	117054914	missense	probably damaging	1.00
Z1177:Pkd1l2	UTSW	8	117030691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGACCCATTGTGAGGTGAG -3'
(R):5'- GTTCAGGAGACCATACAAGCTAAC -3'

Posted On

2017-07-14