Incidental Mutation 'R6084:Myt1l'
ID482415
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Namemyelin transcription factor 1-like
SynonymsC630034G21Rik, Nztf1, 2900046C06Rik, 2900093J19Rik, Png-1, Pmng1
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location29528384-29923213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29832332 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 509 (G509R)
Ref Sequence ENSEMBL: ENSMUSP00000151588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218583]
Predicted Effect unknown
Transcript: ENSMUST00000021009
AA Change: G509R
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911
AA Change: G509R

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000049784
AA Change: G511R
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911
AA Change: G511R

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218583
AA Change: G509R
Meta Mutation Damage Score 0.6392 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29827424 missense unknown
IGL00896:Myt1l APN 12 29826886 missense unknown
IGL01653:Myt1l APN 12 29910771 missense unknown
IGL02632:Myt1l APN 12 29914293 missense unknown
IGL03088:Myt1l APN 12 29920477 missense probably benign 0.03
IGL03212:Myt1l APN 12 29827820 missense unknown
R0057:Myt1l UTSW 12 29842612 splice site probably null
R0126:Myt1l UTSW 12 29851720 missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29811501 missense unknown
R0538:Myt1l UTSW 12 29842571 missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29811635 missense unknown
R0629:Myt1l UTSW 12 29811485 missense unknown
R0709:Myt1l UTSW 12 29827733 missense unknown
R0736:Myt1l UTSW 12 29827814 missense unknown
R0920:Myt1l UTSW 12 29886139 missense unknown
R1618:Myt1l UTSW 12 29827397 missense unknown
R1660:Myt1l UTSW 12 29895273 missense unknown
R1716:Myt1l UTSW 12 29811538 missense unknown
R1758:Myt1l UTSW 12 29827242 missense unknown
R1852:Myt1l UTSW 12 29851661 missense probably benign 0.27
R1971:Myt1l UTSW 12 29827092 missense unknown
R2120:Myt1l UTSW 12 29783619 critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29826970 missense unknown
R2865:Myt1l UTSW 12 29910789 missense probably benign 0.00
R4587:Myt1l UTSW 12 29910801 missense unknown
R4603:Myt1l UTSW 12 29842540 missense probably benign 0.01
R4659:Myt1l UTSW 12 29849457 missense probably damaging 0.98
R4734:Myt1l UTSW 12 29919926 missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29811458 missense unknown
R4824:Myt1l UTSW 12 29849400 missense probably benign 0.02
R4835:Myt1l UTSW 12 29895305 missense unknown
R4888:Myt1l UTSW 12 29886139 missense unknown
R4976:Myt1l UTSW 12 29832303 missense unknown
R4980:Myt1l UTSW 12 29827039 missense unknown
R5119:Myt1l UTSW 12 29832303 missense unknown
R5194:Myt1l UTSW 12 29811648 missense unknown
R5247:Myt1l UTSW 12 29832332 missense unknown
R5249:Myt1l UTSW 12 29832332 missense unknown
R5427:Myt1l UTSW 12 29832332 missense unknown
R5428:Myt1l UTSW 12 29832332 missense unknown
R5429:Myt1l UTSW 12 29832332 missense unknown
R5431:Myt1l UTSW 12 29832332 missense unknown
R5628:Myt1l UTSW 12 29811621 missense unknown
R5926:Myt1l UTSW 12 29832332 missense unknown
R5959:Myt1l UTSW 12 29920040 critical splice donor site probably null
R6082:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29842519 missense probably damaging 1.00
R6086:Myt1l UTSW 12 29832332 missense unknown
R6145:Myt1l UTSW 12 29832381 missense unknown
R6293:Myt1l UTSW 12 29827628 missense unknown
R6315:Myt1l UTSW 12 29827798 missense unknown
R6458:Myt1l UTSW 12 29895299 missense unknown
R6490:Myt1l UTSW 12 29832366 missense unknown
R6758:Myt1l UTSW 12 29842600 missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29783874 missense probably damaging 0.99
R7330:Myt1l UTSW 12 29851554 missense unknown
R7545:Myt1l UTSW 12 29827088 missense unknown
R7662:Myt1l UTSW 12 29826869 missense unknown
R7744:Myt1l UTSW 12 29827549 missense unknown
U24488:Myt1l UTSW 12 29826896 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTATCATGTAACACACGGG -3'
(R):5'- CACTGAGGTGCCATGAAGATG -3'

Posted On2017-07-14