Incidental Mutation 'R6084:Hif1a'
ID 482416
Institutional Source Beutler Lab
Gene Symbol Hif1a
Ensembl Gene ENSMUSG00000021109
Gene Name hypoxia inducible factor 1, alpha subunit
Synonyms bHLHe78, HIF1alpha, MOP1, HIF-1alpha
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6084 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73901375-73947530 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 73941842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 537 (F537C)
Ref Sequence ENSEMBL: ENSMUSP00000106088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021530] [ENSMUST00000110461]
AlphaFold Q61221
Predicted Effect possibly damaging
Transcript: ENSMUST00000021530
AA Change: F563C

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021530
Gene: ENSMUSG00000021109
AA Change: F563C

DomainStartEndE-ValueType
HLH 23 78 1.29e-8 SMART
PAS 87 153 1.05e-9 SMART
PAS 230 296 2.08e-8 SMART
PAC 302 345 6.85e-9 SMART
low complexity region 416 427 N/A INTRINSIC
Pfam:HIF-1 564 594 5.4e-18 PFAM
low complexity region 621 645 N/A INTRINSIC
Pfam:HIF-1a_CTAD 799 835 3.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110461
AA Change: F537C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106088
Gene: ENSMUSG00000021109
AA Change: F537C

DomainStartEndE-ValueType
HLH 11 66 1.29e-8 SMART
PAS 75 141 1.05e-9 SMART
PAS 218 284 2.08e-8 SMART
PAC 290 333 6.85e-9 SMART
low complexity region 404 415 N/A INTRINSIC
Pfam:HIF-1 536 569 6e-19 PFAM
low complexity region 595 619 N/A INTRINSIC
Pfam:HIF-1a_CTAD 771 810 1.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221427
Predicted Effect probably benign
Transcript: ENSMUST00000221833
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha subunit which, along with the beta subunit, forms a heterodimeric transcription factor that regulates the cellular and developmental response to reduced oxygen tension. The transcription factor has been shown to regulate genes involved in several biological processes, including erythropoiesis and angiogenesis which aid in increased delivery of oxygen to hypoxic regions. The transcription factor also plays a role in the induction of genes involved in cell proliferation and survival, energy metabolism, apoptosis, and glucose and iron metabolism. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants die during embryonic development with severe cardiovascular malformations, neural tube defects, cephalic defects, reduced somite number and increased hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Hif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hif1a APN 12 73942010 missense probably damaging 1.00
IGL01396:Hif1a APN 12 73940533 missense probably benign 0.00
IGL02230:Hif1a APN 12 73932450 missense probably damaging 1.00
IGL02561:Hif1a APN 12 73942206 missense possibly damaging 0.52
IGL02698:Hif1a APN 12 73930771 critical splice donor site probably null
IGL03027:Hif1a APN 12 73940477 missense probably benign 0.03
lightweight UTSW 12 73941800 missense probably damaging 1.00
R0597:Hif1a UTSW 12 73942275 missense probably benign 0.00
R0614:Hif1a UTSW 12 73945631 missense probably damaging 1.00
R0678:Hif1a UTSW 12 73944191 splice site probably null
R0967:Hif1a UTSW 12 73937670 missense possibly damaging 0.91
R1351:Hif1a UTSW 12 73940461 missense probably benign 0.00
R1387:Hif1a UTSW 12 73942292 missense possibly damaging 0.95
R1858:Hif1a UTSW 12 73944155 missense probably benign
R2105:Hif1a UTSW 12 73937745 missense probably damaging 1.00
R2194:Hif1a UTSW 12 73930747 missense probably damaging 0.98
R4825:Hif1a UTSW 12 73932401 missense probably damaging 1.00
R4924:Hif1a UTSW 12 73939557 missense probably damaging 1.00
R5386:Hif1a UTSW 12 73944093 missense probably benign 0.02
R5594:Hif1a UTSW 12 73937792 nonsense probably null
R5722:Hif1a UTSW 12 73941759 missense probably benign 0.00
R5818:Hif1a UTSW 12 73939564 missense possibly damaging 0.64
R5831:Hif1a UTSW 12 73942144 missense probably benign
R6026:Hif1a UTSW 12 73932281 missense probably damaging 1.00
R6059:Hif1a UTSW 12 73941800 missense probably damaging 1.00
R6818:Hif1a UTSW 12 73945563 nonsense probably null
R6878:Hif1a UTSW 12 73928281 missense possibly damaging 0.49
R8028:Hif1a UTSW 12 73942027 missense probably benign 0.27
R8286:Hif1a UTSW 12 73945248 intron probably benign
R8322:Hif1a UTSW 12 73939599 missense probably benign
R8414:Hif1a UTSW 12 73937654 missense probably benign 0.00
R8729:Hif1a UTSW 12 73944128 missense probably damaging 1.00
R9030:Hif1a UTSW 12 73936236 missense probably damaging 1.00
R9087:Hif1a UTSW 12 73942325 missense probably benign 0.01
R9093:Hif1a UTSW 12 73932337 missense probably benign 0.12
R9300:Hif1a UTSW 12 73940528 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GACAACATTTGTGGCTGGTC -3'
(R):5'- AACTGGAAATCATCATCCATTGGG -3'

Posted On 2017-07-14