Incidental Mutation 'R6084:Tecpr2'
ID482418
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110929109 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 343 (K343N)
Ref Sequence ENSEMBL: ENSMUSP00000126749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect probably damaging
Transcript: ENSMUST00000165978
AA Change: K343N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: K343N

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169597
AA Change: K343N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: K343N

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221605
Predicted Effect possibly damaging
Transcript: ENSMUST00000223210
AA Change: K343N

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223246
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
R7922:Tecpr2 UTSW 12 110932642 frame shift probably null
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8393:Tecpr2 UTSW 12 110944757 missense probably damaging 0.99
R8411:Tecpr2 UTSW 12 110931720 missense possibly damaging 0.63
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGGAACTGCCATGACAAAATCC -3'
(R):5'- TGTGTGTAAACCCCGATGAC -3'

Posted On2017-07-14