Incidental Mutation 'R0517:Fam208b'
ID48242
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission 038710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0517 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3566964 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2367 (T2367S)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000096069] [ENSMUST00000222365] [ENSMUST00000223396]
Predicted Effect probably benign
Transcript: ENSMUST00000059515
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000096069
AA Change: T2367S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: T2367S

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect probably benign
Transcript: ENSMUST00000221581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221629
Predicted Effect probably benign
Transcript: ENSMUST00000222365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222615
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: T1685S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223046
Predicted Effect probably benign
Transcript: ENSMUST00000223396
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0016:Fam208b UTSW 13 3585170 unclassified probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5076:Fam208b UTSW 13 3576357 missense probably benign 0.41
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGGCTACAAGTGACATCACTGGAC -3'
(R):5'- CAGTTAATGCTACCCCAGGACAGC -3'

Sequencing Primer
(F):5'- CATCACTGGACAAAGTTAAAGCTG -3'
(R):5'- TAAGTCCAGAGGATGCTTGCC -3'
Posted On2013-06-12