Incidental Mutation 'R6084:Ecm2'
ID482420
Institutional Source Beutler Lab
Gene Symbol Ecm2
Ensembl Gene ENSMUSG00000043631
Gene Nameextracellular matrix protein 2, female organ and adipocyte specific
Synonymstenonectin, 9030618O22Rik
MMRRC Submission 044243-MU
Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6084 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49504810-49532789 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 49515094 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 91 (L91*)
Ref Sequence ENSEMBL: ENSMUSP00000060402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]
AlphaFold Q5FW85
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000051504
AA Change: L91*
SMART Domains Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: L91*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
VWC 98 152 1.37e-11 SMART
coiled coil region 235 269 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
LRR 314 336 1.41e2 SMART
LRR 337 362 1.76e-1 SMART
LRR 363 386 5.41e0 SMART
LRR 408 433 1.91e1 SMART
LRR 434 457 4.98e-1 SMART
LRR 459 478 8.03e1 SMART
LRR 506 528 2.76e1 SMART
LRR 529 549 1.19e2 SMART
LRR 578 600 1.81e1 SMART
LRR 601 624 9.48e0 SMART
LRR 631 655 6.06e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222592
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Spidr A T 16: 16,140,024 S80T possibly damaging Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Ecm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Ecm2 APN 13 49531318 missense probably benign 0.14
IGL01685:Ecm2 APN 13 49528898 missense probably damaging 1.00
IGL02070:Ecm2 APN 13 49518370 missense probably damaging 1.00
IGL02108:Ecm2 APN 13 49518444 nonsense probably null
IGL02138:Ecm2 APN 13 49522828 missense probably damaging 1.00
IGL02937:Ecm2 APN 13 49518476 missense probably damaging 0.99
IGL03350:Ecm2 APN 13 49520944 missense probably benign
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0627:Ecm2 UTSW 13 49521083 splice site probably benign
R1515:Ecm2 UTSW 13 49518332 missense possibly damaging 0.87
R1864:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1865:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1991:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2103:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2181:Ecm2 UTSW 13 49530289 missense probably damaging 1.00
R2209:Ecm2 UTSW 13 49530156 missense probably damaging 1.00
R2568:Ecm2 UTSW 13 49530129 missense possibly damaging 0.81
R4856:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R4867:Ecm2 UTSW 13 49531345 missense probably damaging 0.99
R4886:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R5368:Ecm2 UTSW 13 49520943 missense probably benign
R5420:Ecm2 UTSW 13 49527734 missense possibly damaging 0.65
R6244:Ecm2 UTSW 13 49530307 missense probably damaging 1.00
R6881:Ecm2 UTSW 13 49530342 nonsense probably null
R6931:Ecm2 UTSW 13 49529011 missense probably benign 0.00
R7085:Ecm2 UTSW 13 49520902 missense probably damaging 1.00
R7347:Ecm2 UTSW 13 49515078 missense probably damaging 0.99
R7490:Ecm2 UTSW 13 49530342 nonsense probably null
R8039:Ecm2 UTSW 13 49514850 missense probably benign
R8131:Ecm2 UTSW 13 49518464 missense probably benign 0.33
R8333:Ecm2 UTSW 13 49518383 missense probably damaging 1.00
R8345:Ecm2 UTSW 13 49520800 missense probably benign 0.00
R9042:Ecm2 UTSW 13 49528963 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGAAGACTCAGGAAAAGCTCTTC -3'
(R):5'- GTGAAAGGCGTTTTACTGATTGAC -3'

Posted On2017-07-14