Incidental Mutation 'R6084:Spidr'
ID 482423
Institutional Source Beutler Lab
Gene Symbol Spidr
Ensembl Gene ENSMUSG00000041974
Gene Name scaffolding protein involved in DNA repair
Synonyms 2310008H04Rik
MMRRC Submission 044243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6084 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 15889224-16146851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16140024 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 80 (S80T)
Ref Sequence ENSEMBL: ENSMUSP00000038820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040248]
AlphaFold Q8BGX7
Predicted Effect possibly damaging
Transcript: ENSMUST00000040248
AA Change: S80T

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038820
Gene: ENSMUSG00000041974
AA Change: S80T

DomainStartEndE-ValueType
Pfam:DUF4502 11 390 1.8e-177 PFAM
low complexity region 499 508 N/A INTRINSIC
Pfam:DUF4503 540 921 2.2e-179 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229846
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,670,954 D958G possibly damaging Het
Bag4 T C 8: 25,771,231 T161A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cacna2d2 T C 9: 107,497,521 probably null Het
Cass4 G T 2: 172,426,912 A307S probably benign Het
Cbln4 A T 2: 172,042,096 V68E probably damaging Het
Cc2d2a T A 5: 43,668,673 N2K probably benign Het
Ccnf T A 17: 24,231,837 D389V probably damaging Het
Cdipt T C 7: 126,979,601 S161P probably benign Het
Ceacam19 T C 7: 19,882,887 I161V probably benign Het
Cfap65 A G 1: 74,920,405 I862T probably damaging Het
Cfi T A 3: 129,858,370 L230Q probably benign Het
Chac2 G A 11: 30,986,159 R30W probably damaging Het
Cmc2 G A 8: 116,889,827 probably benign Het
Col1a2 A T 6: 4,505,840 M1L probably benign Het
Cox8a C A 19: 7,217,418 R32L possibly damaging Het
Cubn T A 2: 13,430,897 N1083Y probably damaging Het
D430042O09Rik G A 7: 125,814,865 G394R probably benign Het
D630003M21Rik T C 2: 158,217,584 D132G probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Dnaaf3 T C 7: 4,524,213 D358G probably benign Het
Dysf T A 6: 84,019,604 F29L probably damaging Het
Dysf T C 6: 84,112,119 L888P probably damaging Het
Ebf4 A G 2: 130,309,723 D277G probably damaging Het
Ecm2 T A 13: 49,515,094 L91* probably null Het
Foxs1 T C 2: 152,932,842 D97G possibly damaging Het
Frs2 A C 10: 117,076,809 probably null Het
Gm6768 A G 12: 119,261,651 noncoding transcript Het
Grp A T 18: 65,879,937 D58V probably damaging Het
Hif1a T G 12: 73,941,842 F537C probably damaging Het
Icam4 G A 9: 21,029,539 S29N probably benign Het
Itfg1 T C 8: 85,726,170 E523G probably benign Het
Jph2 T C 2: 163,375,680 K359E probably damaging Het
Kcnq2 A T 2: 181,087,656 V490E possibly damaging Het
Klhl18 C T 9: 110,428,727 M548I possibly damaging Het
Lpin3 A G 2: 160,895,801 Y197C probably benign Het
Lrp1 T C 10: 127,560,553 N2381D probably benign Het
Man1a A T 10: 53,919,211 W649R probably damaging Het
Map4 T C 9: 110,064,292 L542P probably damaging Het
Mboat2 A T 12: 24,878,285 H52L probably damaging Het
Mok C G 12: 110,814,946 S91T probably benign Het
Mtmr11 G T 3: 96,168,084 R360L probably damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Olfr1288 A T 2: 111,479,389 N202Y probably damaging Het
Olfr341 A G 2: 36,479,512 V206A probably benign Het
Olfr544 T C 7: 102,484,389 T244A probably damaging Het
Olfr67 C T 7: 103,787,955 M107I probably benign Het
Olfr836 A G 9: 19,121,327 D121G probably damaging Het
Olfr867 A T 9: 20,054,883 H75Q possibly damaging Het
Padi3 G T 4: 140,795,843 T292N probably damaging Het
Pard6g A C 18: 80,117,205 T178P possibly damaging Het
Pkd1l2 A T 8: 117,013,987 Y2124N probably damaging Het
Plxdc1 G A 11: 97,928,463 T398I probably damaging Het
Prickle2 A T 6: 92,416,848 C225* probably null Het
Prmt2 G A 10: 76,210,444 T317I probably benign Het
Psg22 T G 7: 18,719,780 N172K probably benign Het
Ptpn9 C T 9: 57,033,163 R196* probably null Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rapgef4 T A 2: 72,196,278 probably null Het
Rlf A T 4: 121,149,215 M856K possibly damaging Het
Rnf149 A G 1: 39,577,174 L34P probably benign Het
Rock1 T C 18: 10,101,007 E636G probably benign Het
Rsad2 A T 12: 26,454,123 Y136N probably damaging Het
Ryr3 T C 2: 112,908,493 H563R probably damaging Het
Slc18b1 A G 10: 23,804,212 M102V probably benign Het
Slc34a2 T A 5: 53,067,647 C377S possibly damaging Het
Slco1c1 T C 6: 141,546,770 V293A probably benign Het
Syne1 C T 10: 5,348,994 E1031K probably damaging Het
Synj2 G A 17: 6,017,614 V121I probably damaging Het
Synj2 A T 17: 6,038,098 T1430S probably damaging Het
Tecpr2 G T 12: 110,929,109 K343N probably damaging Het
Tmem132d T A 5: 127,784,100 I986F probably benign Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Ttll10 T A 4: 156,045,357 D283V probably benign Het
Ttn T A 2: 76,814,779 K673* probably null Het
Ubqlnl T A 7: 104,148,698 M531L probably benign Het
Vmn2r120 A T 17: 57,525,721 W153R probably benign Het
Vmn2r2 A C 3: 64,117,046 S705A probably benign Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r54 T A 7: 12,632,278 Q243L probably damaging Het
Wdr24 C A 17: 25,824,530 R109S probably damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp426 G T 9: 20,470,627 Q341K possibly damaging Het
Zfp616 A T 11: 74,083,846 K314* probably null Het
Other mutations in Spidr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Spidr APN 16 15895578 missense probably damaging 1.00
IGL00482:Spidr APN 16 16114969 missense possibly damaging 0.94
IGL01760:Spidr APN 16 15912560 missense possibly damaging 0.71
IGL02142:Spidr APN 16 16048081 missense probably benign 0.25
IGL02392:Spidr APN 16 15889630 makesense probably null
IGL02430:Spidr APN 16 16114910 missense probably damaging 1.00
IGL03110:Spidr APN 16 15889754 missense probably damaging 1.00
R0011:Spidr UTSW 16 15966603 missense probably benign 0.00
R0504:Spidr UTSW 16 16140072 missense possibly damaging 0.73
R0505:Spidr UTSW 16 16037667 missense probably damaging 1.00
R0541:Spidr UTSW 16 15915365 missense probably damaging 1.00
R0675:Spidr UTSW 16 16037634 missense probably damaging 1.00
R0722:Spidr UTSW 16 15912781 missense probably damaging 1.00
R2005:Spidr UTSW 16 16048049 missense probably damaging 1.00
R2133:Spidr UTSW 16 16053273 missense probably benign 0.04
R2249:Spidr UTSW 16 16118923 missense probably damaging 1.00
R2876:Spidr UTSW 16 15912589 splice site probably null
R3087:Spidr UTSW 16 15968619 missense probably damaging 1.00
R3121:Spidr UTSW 16 16140860 missense probably damaging 1.00
R3765:Spidr UTSW 16 15968640 missense probably benign 0.39
R4896:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R4939:Spidr UTSW 16 16140746 nonsense probably null
R5004:Spidr UTSW 16 16118942 missense possibly damaging 0.70
R5042:Spidr UTSW 16 16118903 missense probably benign 0.09
R5736:Spidr UTSW 16 15897298 missense probably damaging 1.00
R5839:Spidr UTSW 16 16037502 missense probably damaging 1.00
R5970:Spidr UTSW 16 16114869 missense probably damaging 1.00
R6386:Spidr UTSW 16 15968560 missense probably benign 0.02
R6572:Spidr UTSW 16 15912516 splice site probably null
R7238:Spidr UTSW 16 15966816 missense probably benign 0.10
R7249:Spidr UTSW 16 15966648 missense probably benign 0.00
R7334:Spidr UTSW 16 16114825 critical splice donor site probably null
R7393:Spidr UTSW 16 16146831 start gained probably benign
R7681:Spidr UTSW 16 15895624 missense probably damaging 1.00
R7818:Spidr UTSW 16 16114865 missense probably damaging 1.00
R8247:Spidr UTSW 16 15968526 critical splice donor site probably null
R8472:Spidr UTSW 16 16140727 missense probably benign 0.21
R8507:Spidr UTSW 16 15968676 missense probably damaging 1.00
R8854:Spidr UTSW 16 15889766 missense probably damaging 0.99
R9201:Spidr UTSW 16 15912692 missense possibly damaging 0.46
R9211:Spidr UTSW 16 16053455 missense probably benign 0.13
R9216:Spidr UTSW 16 16118950 missense probably benign 0.22
R9272:Spidr UTSW 16 16037680 missense probably damaging 1.00
R9276:Spidr UTSW 16 15966848 missense probably benign 0.00
X0025:Spidr UTSW 16 15889752 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTAAGGTCACTGTCAATAAATC -3'
(R):5'- TCTCTAAGGACTACATGTTTTGGG -3'

Posted On 2017-07-14