Incidental Mutation 'R6085:Taar7e'
ID482434
Institutional Source Beutler Lab
Gene Symbol Taar7e
Ensembl Gene ENSMUSG00000100689
Gene Nametrace amine-associated receptor 7E
SynonymsLOC276742
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24037614-24038690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24037863 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 84 (F84L)
Ref Sequence ENSEMBL: ENSMUSP00000090326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092656]
Predicted Effect probably benign
Transcript: ENSMUST00000092656
AA Change: F84L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000090326
Gene: ENSMUSG00000100689
AA Change: F84L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 261 5.4e-8 PFAM
Pfam:7TM_GPCR_Srsx 58 341 4.3e-10 PFAM
Pfam:7tm_1 64 326 9.4e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Taar7e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Taar7e APN 10 24038140 missense probably benign
IGL03150:Taar7e APN 10 24037630 missense probably benign 0.01
IGL03366:Taar7e APN 10 24037915 missense probably damaging 1.00
R2013:Taar7e UTSW 10 24037834 missense possibly damaging 0.63
R2095:Taar7e UTSW 10 24038051 nonsense probably null
R4210:Taar7e UTSW 10 24038034 missense probably damaging 1.00
R4211:Taar7e UTSW 10 24038034 missense probably damaging 1.00
R4766:Taar7e UTSW 10 24038566 missense probably damaging 0.99
R6117:Taar7e UTSW 10 24038529 missense probably damaging 0.98
R6918:Taar7e UTSW 10 24037615 start codon destroyed probably null 0.15
R7410:Taar7e UTSW 10 24038526 missense probably benign
R7913:Taar7e UTSW 10 24038004 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGCTGTGCTATGAGAACCTG -3'
(R):5'- CAGTAAACCTGGTGGGGTAGATC -3'

Sequencing Primer
(F):5'- CCTGAACAGGTCCTGTGTCAGAAG -3'
(R):5'- GGGGTCACTGACTGCAATATATC -3'
Posted On2017-07-14