Incidental Mutation 'R6085:Ddx21'
ID482435
Institutional Source Beutler Lab
Gene Symbol Ddx21
Ensembl Gene ENSMUSG00000020075
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 21
SynonymsD10Wsu42e, RH II/Gu, D10Ertd645e, RH-II/Gualpha
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62580251-62602281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62594087 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 293 (Y293H)
Ref Sequence ENSEMBL: ENSMUSP00000042691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045866]
PDB Structure
Gu_alpha_helicase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045866
AA Change: Y293H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042691
Gene: ENSMUSG00000020075
AA Change: Y293H

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 107 139 N/A INTRINSIC
internal_repeat_1 140 160 2.96e-8 PROSPERO
low complexity region 162 171 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
internal_repeat_1 214 234 2.96e-8 PROSPERO
DEXDc 277 484 2.76e-56 SMART
HELICc 524 604 1.55e-27 SMART
low complexity region 682 688 N/A INTRINSIC
Pfam:GUCT 692 787 1.6e-33 PFAM
low complexity region 827 843 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220060
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an antigen recognized by autoimmune antibodies from a patient with watermelon stomach disease. This protein unwinds double-stranded RNA, folds single-stranded RNA, and may play important roles in ribosomal RNA biogenesis, RNA editing, RNA transport, and general transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Ddx21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Ddx21 APN 10 62598402 nonsense probably null
IGL01144:Ddx21 APN 10 62598550 missense unknown
IGL01655:Ddx21 APN 10 62587491 missense probably damaging 0.98
IGL01694:Ddx21 APN 10 62598651 nonsense probably null
IGL01752:Ddx21 APN 10 62587507 missense probably damaging 1.00
IGL02827:Ddx21 APN 10 62598374 missense probably benign 0.04
IGL03140:Ddx21 APN 10 62594071 missense probably damaging 1.00
IGL03248:Ddx21 APN 10 62591990 missense possibly damaging 0.87
R0131:Ddx21 UTSW 10 62584752 missense possibly damaging 0.96
R0555:Ddx21 UTSW 10 62587528 missense probably damaging 1.00
R1437:Ddx21 UTSW 10 62598590 missense unknown
R1780:Ddx21 UTSW 10 62594147 splice site probably benign
R1875:Ddx21 UTSW 10 62594068 missense probably damaging 1.00
R2696:Ddx21 UTSW 10 62594092 missense possibly damaging 0.93
R4639:Ddx21 UTSW 10 62591837 nonsense probably null
R4678:Ddx21 UTSW 10 62594003 missense probably benign 0.06
R4767:Ddx21 UTSW 10 62591972 missense probably damaging 1.00
R4799:Ddx21 UTSW 10 62588121 missense probably damaging 0.98
R5145:Ddx21 UTSW 10 62587539 critical splice acceptor site probably null
R5243:Ddx21 UTSW 10 62602213 start codon destroyed probably null 0.02
R6701:Ddx21 UTSW 10 62590691 missense probably damaging 1.00
R7134:Ddx21 UTSW 10 62591855 missense possibly damaging 0.95
R7517:Ddx21 UTSW 10 62588790 missense probably damaging 0.98
R7555:Ddx21 UTSW 10 62598243 missense probably benign 0.03
R7577:Ddx21 UTSW 10 62590670 missense probably benign 0.19
R7704:Ddx21 UTSW 10 62594086 missense probably damaging 1.00
Z1177:Ddx21 UTSW 10 62587538 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCCTATCTCAGATACACGG -3'
(R):5'- CCCTAATTCTGTAGGACCACTAGTATG -3'

Sequencing Primer
(F):5'- CGGAGTGAGACAAGAACCTC -3'
(R):5'- GGACCACTAGTATGACTGTATGACTG -3'
Posted On2017-07-14