Incidental Mutation 'R6085:Hs3st3a1'
ID482437
Institutional Source Beutler Lab
Gene Symbol Hs3st3a1
Ensembl Gene ENSMUSG00000047759
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Synonyms3Ost3a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6085 (G1)
Quality Score163.009
Status Not validated
Chromosome11
Chromosomal Location64435332-64522841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64436178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 38 (V38I)
Ref Sequence ENSEMBL: ENSMUSP00000055930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058652] [ENSMUST00000177999]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058652
AA Change: V38I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055930
Gene: ENSMUSG00000047759
AA Change: V38I

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 28 320 2.5e-11 PFAM
Pfam:Sulfotransfer_1 139 385 7.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177999
SMART Domains Protein: ENSMUSP00000137599
Gene: ENSMUSG00000095224

DomainStartEndE-ValueType
low complexity region 103 117 N/A INTRINSIC
low complexity region 156 182 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. The sulfotransferase domain of this enzyme is highly similar to the same domain of heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3B1, and these two enzymes sulfate an identical disaccharide. This gene is widely expressed, with the most abundant expression in liver and placenta. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Hs3st3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02126:Hs3st3a1 APN 11 64436505 missense probably damaging 1.00
R1621:Hs3st3a1 UTSW 11 64436223 missense probably benign 0.00
R1900:Hs3st3a1 UTSW 11 64520442 missense probably damaging 0.99
R3429:Hs3st3a1 UTSW 11 64436322 missense probably benign
R6369:Hs3st3a1 UTSW 11 64520601 missense probably benign 0.09
R7335:Hs3st3a1 UTSW 11 64520337 missense probably benign 0.40
R8505:Hs3st3a1 UTSW 11 64520788 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAGTGCTTGGTCCCTAGTTC -3'
(R):5'- TTCTTCACGCCGATGATGATG -3'

Sequencing Primer
(F):5'- AGCTCTCAGGCACGCAG -3'
(R):5'- TGCCCTCGTCCAGAAGTAAG -3'
Posted On2017-07-14