Incidental Mutation 'R6085:Slc25a47'
ID482442
Institutional Source Beutler Lab
Gene Symbol Slc25a47
Ensembl Gene ENSMUSG00000048856
Gene Namesolute carrier family 25, member 47
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location108836046-108856815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108854328 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 86 (Y86C)
Ref Sequence ENSEMBL: ENSMUSP00000152260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057026] [ENSMUST00000221080]
Predicted Effect probably benign
Transcript: ENSMUST00000057026
AA Change: Y86C

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050329
Gene: ENSMUSG00000048856
AA Change: Y86C

DomainStartEndE-ValueType
Pfam:Mito_carr 1 84 1.2e-19 PFAM
Pfam:Mito_carr 94 212 1.5e-19 PFAM
Pfam:Mito_carr 215 308 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221080
AA Change: Y86C

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Slc25a47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc25a47 APN 12 108855388 missense probably benign 0.00
IGL01138:Slc25a47 APN 12 108856022 missense probably damaging 1.00
IGL01545:Slc25a47 APN 12 108854216 missense probably benign 0.06
IGL01978:Slc25a47 APN 12 108851190 missense probably damaging 0.96
R0592:Slc25a47 UTSW 12 108854258 missense probably damaging 0.98
R4783:Slc25a47 UTSW 12 108855334 missense probably damaging 1.00
R5549:Slc25a47 UTSW 12 108856217 makesense probably null
R6378:Slc25a47 UTSW 12 108856143 missense probably damaging 1.00
R6612:Slc25a47 UTSW 12 108855978 missense probably benign 0.02
R7237:Slc25a47 UTSW 12 108855460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGGCATTTTCTCTTGG -3'
(R):5'- TCCACTAGAGTATACTGGGAGGG -3'

Sequencing Primer
(F):5'- GCATTTTCTCTTGGCTGGATCCAG -3'
(R):5'- CCTGCAGGGTCTAACTTGTCAGAG -3'
Posted On2017-07-14