Mutagenetix > Incidental Mutations

Incidental Mutation 'R6085:Slc25a47'

482442

Institutional Source

Beutler Lab

Gene Symbol

Slc25a47

Ensembl Gene

ENSMUSG00000048856

Gene Name

solute carrier family 25, member 47

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6085 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108836046-108856815 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108854328 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 86 (Y86C)

Ref Sequence

ENSEMBL: ENSMUSP00000152260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057026] [ENSMUST00000221080]

Predicted Effect

probably benign
Transcript: ENSMUST00000057026
AA Change: Y86C

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000050329
Gene: ENSMUSG00000048856
AA Change: Y86C

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	1	84	1.2e-19	PFAM
Pfam:Mito_carr	94	212	1.5e-19	PFAM
Pfam:Mito_carr	215	308	6.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221080
AA Change: Y86C

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221787

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223296

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Boc	G	T	16: 44,488,607	D847E	probably damaging	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cdk12	T	C	11: 98,243,429	I1051T	unknown	Het
Ciita	A	G	16: 10,512,165	E771G	probably benign	Het
Cul2	T	C	18: 3,431,508	F638L	probably benign	Het
Ddx21	A	G	10: 62,594,087	Y293H	probably damaging	Het
Dhx8	C	T	11: 101,764,313	R1050W	probably damaging	Het
Etv1	G	A	12: 38,854,195	D285N	probably damaging	Het
Gm597	T	C	1: 28,778,227	I241M	possibly damaging	Het
Hs3st3a1	G	A	11: 64,436,178	V38I	possibly damaging	Het
Ifit1bl2	A	C	19: 34,619,817	F133C	possibly damaging	Het
Lama3	C	T	18: 12,482,099	T1360I	probably benign	Het
Mgrn1	A	G	16: 4,920,376	T265A	probably benign	Het
Nup155	T	C	15: 8,148,358	V1075A	probably damaging	Het
Olfr1378	A	G	11: 50,969,123	Y35C	probably damaging	Het
Pld4	A	G	12: 112,766,886	T299A	probably benign	Het
Prr5	T	A	15: 84,687,905	I38N	probably damaging	Het
Synrg	A	T	11: 84,039,661	E1276D	possibly damaging	Het
Taar7e	T	C	10: 24,037,863	F84L	probably benign	Het
Tssk1	G	A	16: 17,894,984	C211Y	possibly damaging	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Xpo7	A	T	14: 70,696,611	S236T	probably benign	Het

Other mutations in Slc25a47

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Slc25a47	APN	12	108855388	missense	probably benign	0.00
IGL01138:Slc25a47	APN	12	108856022	missense	probably damaging	1.00
IGL01545:Slc25a47	APN	12	108854216	missense	probably benign	0.06
IGL01978:Slc25a47	APN	12	108851190	missense	probably damaging	0.96
R0592:Slc25a47	UTSW	12	108854258	missense	probably damaging	0.98
R4783:Slc25a47	UTSW	12	108855334	missense	probably damaging	1.00
R5549:Slc25a47	UTSW	12	108856217	makesense	probably null
R6378:Slc25a47	UTSW	12	108856143	missense	probably damaging	1.00
R6612:Slc25a47	UTSW	12	108855978	missense	probably benign	0.02
R7237:Slc25a47	UTSW	12	108855460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGGGCATTTTCTCTTGG -3'
(R):5'- TCCACTAGAGTATACTGGGAGGG -3'

Sequencing Primer
(F):5'- GCATTTTCTCTTGGCTGGATCCAG -3'
(R):5'- CCTGCAGGGTCTAACTTGTCAGAG -3'

Posted On

2017-07-14