Incidental Mutation 'R6085:Xpo7'
ID482444
Institutional Source Beutler Lab
Gene Symbol Xpo7
Ensembl Gene ENSMUSG00000022100
Gene Nameexportin 7
Synonyms4930506C02Rik, Ranbp16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70654246-70766628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70696611 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 236 (S236T)
Ref Sequence ENSEMBL: ENSMUSP00000154350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022696] [ENSMUST00000167242] [ENSMUST00000226448] [ENSMUST00000228346]
Predicted Effect probably benign
Transcript: ENSMUST00000022696
AA Change: S235T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022696
Gene: ENSMUSG00000022100
AA Change: S235T

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167242
AA Change: S235T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129504
Gene: ENSMUSG00000022100
AA Change: S235T

DomainStartEndE-ValueType
IBN_N 30 96 3.52e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226448
AA Change: S235T

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226607
Predicted Effect probably benign
Transcript: ENSMUST00000228346
AA Change: S236T

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Other mutations in Xpo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Xpo7 APN 14 70671658 missense probably benign 0.32
IGL01066:Xpo7 APN 14 70701755 missense probably benign 0.01
IGL01610:Xpo7 APN 14 70703230 missense probably damaging 1.00
IGL01716:Xpo7 APN 14 70685555 missense probably damaging 1.00
IGL01885:Xpo7 APN 14 70666035 missense probably benign 0.03
IGL02647:Xpo7 APN 14 70685465 missense probably damaging 1.00
IGL03088:Xpo7 APN 14 70681262 missense probably benign 0.09
IGL03245:Xpo7 APN 14 70688294 missense probably damaging 1.00
froggie UTSW 14 70682347 missense probably damaging 1.00
BB010:Xpo7 UTSW 14 70707348 missense probably benign 0.05
BB020:Xpo7 UTSW 14 70707348 missense probably benign 0.05
PIT4687001:Xpo7 UTSW 14 70667149 missense probably benign 0.22
R0893:Xpo7 UTSW 14 70666097 splice site probably benign
R1222:Xpo7 UTSW 14 70667084 missense possibly damaging 0.55
R1474:Xpo7 UTSW 14 70699033 missense probably benign 0.00
R1509:Xpo7 UTSW 14 70678142 missense probably damaging 0.99
R1867:Xpo7 UTSW 14 70693991 missense probably damaging 1.00
R1898:Xpo7 UTSW 14 70695624 missense probably benign 0.20
R2105:Xpo7 UTSW 14 70690991 missense probably benign 0.02
R2369:Xpo7 UTSW 14 70687731 nonsense probably null
R2937:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2938:Xpo7 UTSW 14 70671690 missense probably damaging 0.99
R2940:Xpo7 UTSW 14 70667136 missense probably damaging 1.00
R2940:Xpo7 UTSW 14 70667137 missense probably benign 0.38
R3001:Xpo7 UTSW 14 70692645 splice site probably benign
R4436:Xpo7 UTSW 14 70669429 missense probably damaging 1.00
R4529:Xpo7 UTSW 14 70668748 missense probably damaging 1.00
R4873:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4875:Xpo7 UTSW 14 70676816 critical splice acceptor site probably null
R4907:Xpo7 UTSW 14 70670629 missense probably benign 0.16
R5007:Xpo7 UTSW 14 70688264 missense probably damaging 1.00
R5282:Xpo7 UTSW 14 70683731 missense probably damaging 1.00
R5346:Xpo7 UTSW 14 70683677 missense probably damaging 1.00
R5522:Xpo7 UTSW 14 70671650 nonsense probably null
R5533:Xpo7 UTSW 14 70693967 missense probably damaging 1.00
R5668:Xpo7 UTSW 14 70682846 missense possibly damaging 0.52
R6042:Xpo7 UTSW 14 70695663 missense possibly damaging 0.47
R6052:Xpo7 UTSW 14 70683719 missense possibly damaging 0.68
R6066:Xpo7 UTSW 14 70682338 missense probably null 0.99
R6180:Xpo7 UTSW 14 70682803 missense probably benign 0.14
R6291:Xpo7 UTSW 14 70704690 nonsense probably null
R6401:Xpo7 UTSW 14 70682347 missense probably damaging 1.00
R6593:Xpo7 UTSW 14 70682362 missense probably damaging 0.99
R6725:Xpo7 UTSW 14 70676813 missense probably damaging 1.00
R6938:Xpo7 UTSW 14 70666024 missense probably benign 0.00
R6996:Xpo7 UTSW 14 70669448 missense probably benign
R7020:Xpo7 UTSW 14 70666023 missense probably benign 0.00
R7053:Xpo7 UTSW 14 70684858 critical splice donor site probably null
R7061:Xpo7 UTSW 14 70671072 missense probably benign 0.04
R7095:Xpo7 UTSW 14 70704706 missense probably damaging 1.00
R7604:Xpo7 UTSW 14 70671670 missense probably damaging 1.00
R7933:Xpo7 UTSW 14 70707348 missense probably benign 0.05
R8044:Xpo7 UTSW 14 70684926 missense probably benign 0.18
R8438:Xpo7 UTSW 14 70703232 missense probably benign 0.02
R8518:Xpo7 UTSW 14 70707397 missense probably damaging 1.00
X0062:Xpo7 UTSW 14 70685528 missense probably damaging 1.00
Z1176:Xpo7 UTSW 14 70692710 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTCCATTAACCCTTAGCATGTTG -3'
(R):5'- CAAGTACAGTTTTCCTTTTGCGGC -3'

Sequencing Primer
(F):5'- CCTTAGCATGTTGTAAACAAACGC -3'
(R):5'- GCTTAATAGCCTACTTCTGAACCTAG -3'
Posted On2017-07-14