Incidental Mutation 'R6085:Bora'
ID482445
Institutional Source Beutler Lab
Gene Symbol Bora
Ensembl Gene ENSMUSG00000022070
Gene Namebora, aurora kinase A activator
Synonyms6720463M24Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location99046222-99074540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99062294 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 234 (Q234L)
Ref Sequence ENSEMBL: ENSMUSP00000154660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022656] [ENSMUST00000227128] [ENSMUST00000227744]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022656
AA Change: Q234L

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022656
Gene: ENSMUSG00000022070
AA Change: Q234L

DomainStartEndE-ValueType
Pfam:BORA_N 7 207 2.4e-69 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227128
Predicted Effect possibly damaging
Transcript: ENSMUST00000227744
AA Change: Q234L

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Bora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Bora APN 14 99047377 missense probably damaging 1.00
IGL02119:Bora APN 14 99053538 missense probably damaging 1.00
IGL02129:Bora APN 14 99056821 critical splice donor site probably null
IGL02171:Bora APN 14 99047322 missense probably damaging 1.00
IGL03338:Bora APN 14 99072742 missense probably damaging 1.00
R0504:Bora UTSW 14 99061623 nonsense probably null
R1598:Bora UTSW 14 99068404 missense probably benign
R2070:Bora UTSW 14 99062278 missense probably damaging 1.00
R2071:Bora UTSW 14 99062278 missense probably damaging 1.00
R4521:Bora UTSW 14 99068548 missense probably damaging 0.99
R4861:Bora UTSW 14 99047474 splice site probably null
R4881:Bora UTSW 14 99061567 missense probably damaging 1.00
R4982:Bora UTSW 14 99047352 missense probably damaging 1.00
R5341:Bora UTSW 14 99068094 missense probably damaging 1.00
R5378:Bora UTSW 14 99068493 missense probably damaging 1.00
R5913:Bora UTSW 14 99068512 missense probably benign 0.02
R6082:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6083:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6084:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6086:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6269:Bora UTSW 14 99073667 missense probably damaging 0.99
R7354:Bora UTSW 14 99047358 missense probably damaging 1.00
R7794:Bora UTSW 14 99072644 missense possibly damaging 0.50
R7962:Bora UTSW 14 99072726 missense probably benign 0.01
R8299:Bora UTSW 14 99068134 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTATCTCTGTTGCAAGGTGCC -3'
(R):5'- CCCTGACTAAGACACTAGTACATTTG -3'

Sequencing Primer
(F):5'- ATCTCTGTTGCAAGGTGCCTTTTG -3'
(R):5'- ACCAAAGCGTTTATTTCCAACTGC -3'
Posted On2017-07-14