Incidental Mutation 'R6085:Tssk1'
ID482451
Institutional Source Beutler Lab
Gene Symbol Tssk1
Ensembl Gene ENSMUSG00000041566
Gene Nametestis-specific serine kinase 1
SynonymsStk22a, TSK-1, Tssk, Tsk1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17894223-17897922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17894984 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 211 (C211Y)
Ref Sequence ENSEMBL: ENSMUSP00000040302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000046937] [ENSMUST00000055374] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000150068] [ENSMUST00000155943]
Predicted Effect probably benign
Transcript: ENSMUST00000012152
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000046937
AA Change: C211Y

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040302
Gene: ENSMUSG00000041566
AA Change: C211Y

DomainStartEndE-ValueType
S_TKc 12 272 3.86e-89 SMART
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055374
SMART Domains Protein: ENSMUSP00000051035
Gene: ENSMUSG00000045521

DomainStartEndE-ValueType
S_TKc 12 272 1.39e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066127
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117082
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117945
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect probably benign
Transcript: ENSMUST00000150068
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155611
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TSSK1 belongs to a family of serine/threonine kinases highly expressed in testis (Hao et al., 2004 [PubMed 15044604]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele of Tssk1 and 2 are infertile due to arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Tssk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Tssk1 APN 16 17894894 missense probably damaging 1.00
R4785:Tssk1 UTSW 16 17895062 missense probably benign 0.01
R5282:Tssk1 UTSW 16 17895259 missense probably benign
R5613:Tssk1 UTSW 16 17894500 missense probably benign 0.35
R5945:Tssk1 UTSW 16 17894701 missense probably damaging 1.00
R6246:Tssk1 UTSW 16 17895439 missense probably benign 0.06
R7537:Tssk1 UTSW 16 17895084 missense probably benign 0.05
R7818:Tssk1 UTSW 16 17894447 missense probably benign 0.01
X0010:Tssk1 UTSW 16 17895224 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTGACTTCGGCTTCTCCAAG -3'
(R):5'- TTGTTGATGGCTCCAGAGGAC -3'

Sequencing Primer
(F):5'- GCTTCTCCAAGCGCTGC -3'
(R):5'- CCAGCAGTGGTTAAGGATCTCATC -3'
Posted On2017-07-14