Incidental Mutation 'R6085:Boc'
ID482452
Institutional Source Beutler Lab
Gene Symbol Boc
Ensembl Gene ENSMUSG00000022687
Gene Namebiregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6085 (G1)
Quality Score213.009
Status Not validated
Chromosome16
Chromosomal Location44485049-44558897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44488607 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 847 (D847E)
Ref Sequence ENSEMBL: ENSMUSP00000110281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114634]
Predicted Effect probably damaging
Transcript: ENSMUST00000023370
AA Change: D847E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023370
Gene: ENSMUSG00000022687
AA Change: D847E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114634
AA Change: D847E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687
AA Change: D847E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Boc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Boc APN 16 44492955 missense probably benign 0.00
IGL00981:Boc APN 16 44491801 missense probably damaging 0.99
IGL01820:Boc APN 16 44491872 missense possibly damaging 0.88
IGL03114:Boc APN 16 44486752 missense probably benign 0.38
IGL03195:Boc APN 16 44492821 missense probably damaging 0.99
R0006:Boc UTSW 16 44496449 missense probably benign 0.41
R0142:Boc UTSW 16 44490241 missense probably damaging 1.00
R0417:Boc UTSW 16 44520234 missense probably benign 0.16
R1066:Boc UTSW 16 44490684 critical splice acceptor site probably null
R1248:Boc UTSW 16 44520473 missense probably benign 0.03
R1438:Boc UTSW 16 44488746 splice site probably null
R1506:Boc UTSW 16 44503565 missense probably damaging 1.00
R1729:Boc UTSW 16 44496419 missense probably benign 0.00
R1784:Boc UTSW 16 44496419 missense probably benign 0.00
R2004:Boc UTSW 16 44501644 critical splice donor site probably null
R2441:Boc UTSW 16 44488623 missense probably damaging 1.00
R2863:Boc UTSW 16 44492960 missense probably benign 0.03
R3885:Boc UTSW 16 44487613 splice site probably benign
R4201:Boc UTSW 16 44490618 missense probably damaging 1.00
R4239:Boc UTSW 16 44491884 missense probably damaging 1.00
R4382:Boc UTSW 16 44491182 missense probably damaging 1.00
R4384:Boc UTSW 16 44491182 missense probably damaging 1.00
R4385:Boc UTSW 16 44491182 missense probably damaging 1.00
R4684:Boc UTSW 16 44500380 missense probably benign 0.07
R4776:Boc UTSW 16 44487721 missense probably damaging 0.99
R4788:Boc UTSW 16 44500433 missense probably damaging 1.00
R4830:Boc UTSW 16 44490157 missense probably damaging 1.00
R5000:Boc UTSW 16 44490154 missense probably damaging 1.00
R5567:Boc UTSW 16 44492824 missense probably damaging 1.00
R5570:Boc UTSW 16 44492824 missense probably damaging 1.00
R5645:Boc UTSW 16 44499661 missense probably damaging 0.99
R5651:Boc UTSW 16 44521195 missense probably benign 0.00
R5881:Boc UTSW 16 44490651 missense probably damaging 1.00
R6021:Boc UTSW 16 44488654 missense probably benign 0.00
R6188:Boc UTSW 16 44499548 missense possibly damaging 0.67
R6295:Boc UTSW 16 44492348 missense probably benign 0.05
R6366:Boc UTSW 16 44487652 missense probably benign 0.04
R6626:Boc UTSW 16 44520440 missense possibly damaging 0.47
R6629:Boc UTSW 16 44492361 missense probably benign 0.11
R6707:Boc UTSW 16 44500616 missense possibly damaging 0.71
R6819:Boc UTSW 16 44492825 missense probably damaging 0.99
R6904:Boc UTSW 16 44491791 missense probably damaging 1.00
R7260:Boc UTSW 16 44490170 missense
R7353:Boc UTSW 16 44485737 missense unknown
R7458:Boc UTSW 16 44486756 missense
R7671:Boc UTSW 16 44491849 missense
R8283:Boc UTSW 16 44520437 missense noncoding transcript
RF028:Boc UTSW 16 44496433 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCTTGAGTTCCCAGGGAG -3'
(R):5'- TCCTATGTCCATGGAATTGAGGTG -3'

Sequencing Primer
(F):5'- TGGAGCTGGACCACTGG -3'
(R):5'- CCATGGAATTGAGGTGCTTTG -3'
Posted On2017-07-14