Incidental Mutation 'R6085:Cul2'
ID482453
Institutional Source Beutler Lab
Gene Symbol Cul2
Ensembl Gene ENSMUSG00000024231
Gene Namecullin 2
Synonyms4932411N15Rik, 1300003D18Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6085 (G1)
Quality Score139.008
Status Not validated
Chromosome18
Chromosomal Location3382988-3436377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3431508 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 638 (F638L)
Ref Sequence ENSEMBL: ENSMUSP00000125403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025073] [ENSMUST00000080089] [ENSMUST00000161317] [ENSMUST00000162301]
Predicted Effect probably benign
Transcript: ENSMUST00000025073
AA Change: F638L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000025073
Gene: ENSMUSG00000024231
AA Change: F638L

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-109 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Pfam:Cullin_Nedd8 651 700 9.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080089
SMART Domains Protein: ENSMUSP00000078988
Gene: ENSMUSG00000024231

DomainStartEndE-ValueType
Pfam:Cullin 14 88 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159443
Predicted Effect probably benign
Transcript: ENSMUST00000161317
AA Change: F575L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123903
Gene: ENSMUSG00000024231
AA Change: F575L

DomainStartEndE-ValueType
CULLIN 353 505 1.19e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161852
Predicted Effect probably benign
Transcript: ENSMUST00000162301
AA Change: F638L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125403
Gene: ENSMUSG00000024231
AA Change: F638L

DomainStartEndE-ValueType
SCOP:d1ldja2 11 386 1e-108 SMART
CULLIN 416 568 1.19e-84 SMART
low complexity region 636 646 N/A INTRINSIC
Cullin_Nedd8 672 739 1.01e-33 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Cul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Cul2 APN 18 3423487 missense probably benign
IGL01293:Cul2 APN 18 3419426 missense probably damaging 0.99
IGL02719:Cul2 APN 18 3434052 missense probably damaging 1.00
IGL02886:Cul2 APN 18 3426920 splice site probably benign
IGL03190:Cul2 APN 18 3429634 missense possibly damaging 0.95
IGL03389:Cul2 APN 18 3431029 missense probably benign 0.00
IGL03409:Cul2 APN 18 3429593 missense probably damaging 1.00
R0238:Cul2 UTSW 18 3414115 splice site probably benign
R1013:Cul2 UTSW 18 3425535 nonsense probably null
R1119:Cul2 UTSW 18 3419335 splice site probably benign
R1743:Cul2 UTSW 18 3426851 missense probably damaging 1.00
R1897:Cul2 UTSW 18 3414164 missense probably benign
R2252:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R2253:Cul2 UTSW 18 3399876 missense probably damaging 1.00
R3898:Cul2 UTSW 18 3434033 missense probably benign 0.07
R4386:Cul2 UTSW 18 3434856 missense probably damaging 1.00
R4579:Cul2 UTSW 18 3430957 missense probably benign 0.00
R4828:Cul2 UTSW 18 3431013 missense probably damaging 1.00
R6429:Cul2 UTSW 18 3421345 missense probably damaging 1.00
R6480:Cul2 UTSW 18 3417561 missense possibly damaging 0.89
R6805:Cul2 UTSW 18 3421263 missense probably damaging 1.00
R6825:Cul2 UTSW 18 3434946 missense probably damaging 0.99
R7343:Cul2 UTSW 18 3426873 missense probably benign 0.08
R7690:Cul2 UTSW 18 3419420 missense probably benign 0.09
R8114:Cul2 UTSW 18 3426164 nonsense probably null
R8414:Cul2 UTSW 18 3399912 missense probably benign 0.08
X0067:Cul2 UTSW 18 3419435 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACTCACTTGTTAGTATTGTGGCTAC -3'
(R):5'- CTGGCAGTCAATAAGGCCAAC -3'

Sequencing Primer
(F):5'- TACTGCAGCAGTTTCAGACAG -3'
(R):5'- ATTAATTTCAGAGTGCAGAGGTTTGC -3'
Posted On2017-07-14