Incidental Mutation 'R6085:Ifit1bl2'
ID482455
Institutional Source Beutler Lab
Gene Symbol Ifit1bl2
Ensembl Gene ENSMUSG00000067297
Gene Nameinterferon induced protein with tetratricopeptide repeats 1B like 2
Synonyms2010002M12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6085 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location34617049-34640743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34619817 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 133 (F133C)
Ref Sequence ENSEMBL: ENSMUSP00000108082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087357] [ENSMUST00000112463]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087357
AA Change: F133C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093816
Gene: ENSMUSG00000067297
AA Change: F133C

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112463
AA Change: F133C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108082
Gene: ENSMUSG00000067297
AA Change: F133C

DomainStartEndE-ValueType
TPR 60 93 2.92e1 SMART
TPR 100 133 6.24e1 SMART
TPR 144 179 4.32e1 SMART
low complexity region 217 230 N/A INTRINSIC
TPR 249 282 2.24e1 SMART
TPR 334 367 4.55e1 SMART
low complexity region 411 421 N/A INTRINSIC
TPR 429 462 1.45e-1 SMART
Meta Mutation Damage Score 0.2849 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Boc G T 16: 44,488,607 D847E probably damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cdk12 T C 11: 98,243,429 I1051T unknown Het
Ciita A G 16: 10,512,165 E771G probably benign Het
Cul2 T C 18: 3,431,508 F638L probably benign Het
Ddx21 A G 10: 62,594,087 Y293H probably damaging Het
Dhx8 C T 11: 101,764,313 R1050W probably damaging Het
Etv1 G A 12: 38,854,195 D285N probably damaging Het
Gm597 T C 1: 28,778,227 I241M possibly damaging Het
Hs3st3a1 G A 11: 64,436,178 V38I possibly damaging Het
Lama3 C T 18: 12,482,099 T1360I probably benign Het
Mgrn1 A G 16: 4,920,376 T265A probably benign Het
Nup155 T C 15: 8,148,358 V1075A probably damaging Het
Olfr1378 A G 11: 50,969,123 Y35C probably damaging Het
Pld4 A G 12: 112,766,886 T299A probably benign Het
Prr5 T A 15: 84,687,905 I38N probably damaging Het
Slc25a47 A G 12: 108,854,328 Y86C probably benign Het
Synrg A T 11: 84,039,661 E1276D possibly damaging Het
Taar7e T C 10: 24,037,863 F84L probably benign Het
Tssk1 G A 16: 17,894,984 C211Y possibly damaging Het
Tymp GC GCC 15: 89,374,364 probably null Het
Xpo7 A T 14: 70,696,611 S236T probably benign Het
Other mutations in Ifit1bl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ifit1bl2 APN 19 34619919 missense probably benign 0.22
IGL00706:Ifit1bl2 APN 19 34618882 missense probably benign 0.09
IGL01322:Ifit1bl2 APN 19 34619004 missense probably benign 0.10
IGL01362:Ifit1bl2 APN 19 34619484 missense probably benign 0.04
IGL03061:Ifit1bl2 APN 19 34619724 missense probably benign 0.41
R0039:Ifit1bl2 UTSW 19 34619446 nonsense probably null
R1079:Ifit1bl2 UTSW 19 34619485 missense probably benign 0.00
R1438:Ifit1bl2 UTSW 19 34619169 missense possibly damaging 0.70
R2050:Ifit1bl2 UTSW 19 34619470 missense possibly damaging 0.75
R2104:Ifit1bl2 UTSW 19 34619520 missense probably benign 0.01
R2228:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R2229:Ifit1bl2 UTSW 19 34619230 missense possibly damaging 0.70
R4468:Ifit1bl2 UTSW 19 34619068 nonsense probably null
R4517:Ifit1bl2 UTSW 19 34629764 start gained probably benign
R5723:Ifit1bl2 UTSW 19 34620058 missense probably benign 0.07
R5935:Ifit1bl2 UTSW 19 34619728 missense probably benign 0.04
R6024:Ifit1bl2 UTSW 19 34620038 missense probably benign 0.00
R6083:Ifit1bl2 UTSW 19 34619817 missense possibly damaging 0.80
R6280:Ifit1bl2 UTSW 19 34620134 missense possibly damaging 0.70
R6368:Ifit1bl2 UTSW 19 34619125 missense probably benign 0.00
R6905:Ifit1bl2 UTSW 19 34619590 missense possibly damaging 0.90
R7048:Ifit1bl2 UTSW 19 34619151 missense probably benign 0.04
R7355:Ifit1bl2 UTSW 19 34619661 missense probably damaging 1.00
R7447:Ifit1bl2 UTSW 19 34619574 missense probably damaging 1.00
R7661:Ifit1bl2 UTSW 19 34619028 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACATCTGCATAGCCAGCGTTG -3'
(R):5'- ATCCCATCTACAGCATCGGG -3'

Sequencing Primer
(F):5'- ATAGCCAGCGTTGTACTCAG -3'
(R):5'- CCTACGTGAGGCACCTGAAAG -3'
Posted On2017-07-14