Incidental Mutation 'R6086:Olfr1230'
ID 482460
Institutional Source Beutler Lab
Gene Symbol Olfr1230
Ensembl Gene ENSMUSG00000075094
Gene Name olfactory receptor 1230
Synonyms GA_x6K02T2Q125-50741934-50741017, MOR237-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R6086 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 89296351-89297268 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89296854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 139 (C139R)
Ref Sequence ENSEMBL: ENSMUSP00000097375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]
AlphaFold Q8VG58
Predicted Effect probably damaging
Transcript: ENSMUST00000099787
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: C139R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-44 PFAM
Pfam:7tm_1 39 285 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Olfr1230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr1230 APN 2 89296455 missense probably benign 0.40
IGL01419:Olfr1230 APN 2 89296345 unclassified probably benign
IGL01644:Olfr1230 APN 2 89296632 missense probably benign 0.01
IGL01653:Olfr1230 APN 2 89297127 missense probably benign 0.08
IGL01674:Olfr1230 APN 2 89296670 missense probably damaging 1.00
IGL02124:Olfr1230 APN 2 89297063 missense probably benign 0.01
IGL03053:Olfr1230 APN 2 89296445 missense probably damaging 0.97
R0504:Olfr1230 UTSW 2 89296739 missense probably damaging 0.99
R1473:Olfr1230 UTSW 2 89296906 nonsense probably null
R1742:Olfr1230 UTSW 2 89296424 missense probably damaging 1.00
R1899:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1900:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1945:Olfr1230 UTSW 2 89296784 missense probably damaging 1.00
R2935:Olfr1230 UTSW 2 89297260 missense possibly damaging 0.69
R3421:Olfr1230 UTSW 2 89296553 missense probably benign 0.03
R5185:Olfr1230 UTSW 2 89296387 missense probably benign
R5377:Olfr1230 UTSW 2 89297162 missense probably damaging 0.99
R5400:Olfr1230 UTSW 2 89296913 missense probably damaging 1.00
R6083:Olfr1230 UTSW 2 89297024 missense probably damaging 1.00
R6155:Olfr1230 UTSW 2 89296421 missense probably damaging 1.00
R6218:Olfr1230 UTSW 2 89296962 missense probably damaging 0.98
R6361:Olfr1230 UTSW 2 89296646 missense probably damaging 0.98
R8053:Olfr1230 UTSW 2 89297196 missense possibly damaging 0.69
R8905:Olfr1230 UTSW 2 89296457 missense possibly damaging 0.89
Z1176:Olfr1230 UTSW 2 89296953 missense probably damaging 1.00
Z1177:Olfr1230 UTSW 2 89296452 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGAGCTAGGATATGGGTGTCC -3'
(R):5'- CGAATCTGAGGTCTCCCATG -3'

Posted On 2017-07-14