Mutagenetix > Incidental Mutation

Incidental Mutation 'R6086:Olfr1230'

482460

Institutional Source

Beutler Lab

Gene Symbol

Olfr1230

Ensembl Gene

ENSMUSG00000075094

Gene Name

olfactory receptor 1230

Synonyms

GA_x6K02T2Q125-50741934-50741017, MOR237-1

MMRRC Submission

044427-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6086 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89296351-89297268 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89296854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 139 (C139R)

Ref Sequence

ENSEMBL: ENSMUSP00000097375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]

AlphaFold

Q8VG58

Predicted Effect

probably damaging
Transcript: ENSMUST00000099787
AA Change: C139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: C139R

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	5.7e-44	PFAM
Pfam:7tm_1	39	285	6.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216144

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

96% (65/68)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110062M04Rik	A	G	6: 34,874,620	S127P	probably damaging	Het
Apob	G	T	12: 8,015,164	K4044N	probably benign	Het
Asic4	G	A	1: 75,473,243	V468I	possibly damaging	Het
Atf4	T	A	15: 80,257,453	V348D	probably benign	Het
Bcl9	A	G	3: 97,205,524	V1205A	possibly damaging	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Cap2	C	A	13: 46,635,712	P131Q	probably damaging	Het
Cdyl2	A	G	8: 116,589,296	S318P	probably damaging	Het
Ces1a	T	G	8: 93,027,353	N341H	probably benign	Het
Crlf3	C	T	11: 80,048,610	V352M	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dnah2	T	C	11: 69,516,008	T529A	probably benign	Het
Dnah9	C	T	11: 65,989,915	D2619N	probably damaging	Het
Dnah9	A	C	11: 66,085,174	S1350A	probably benign	Het
Dnajc6	C	T	4: 101,597,807	S65L	probably benign	Het
Dnm3	C	A	1: 162,321,033	R256S	probably damaging	Het
Enpp2	T	C	15: 54,845,834	D795G	probably damaging	Het
Fah	A	T	7: 84,588,912	W367R	probably damaging	Het
Fam220a	T	A	5: 143,563,041	H69Q	probably benign	Het
Fgd3	T	A	13: 49,287,296	T220S	probably benign	Het
Furin	G	T	7: 80,395,431	H248Q	probably damaging	Het
Gabrg1	A	T	5: 70,754,053	L410Q	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Gm9742	T	C	13: 8,030,033		noncoding transcript	Het
Gpcpd1	A	G	2: 132,538,114	S252P	probably damaging	Het
Hnrnpdl	C	T	5: 100,036,481	G398S	probably null	Het
Hspa1l	T	C	17: 34,978,155	V390A	possibly damaging	Het
Htr3b	T	C	9: 48,947,298	S94G	probably benign	Het
Klf10	G	T	15: 38,296,937	S271R	probably benign	Het
Klk1b3	T	A	7: 44,201,734	L197Q	probably damaging	Het
Knl1	A	G	2: 119,094,068	R1861G	probably damaging	Het
Lexm	T	C	4: 106,613,206	E218G	probably damaging	Het
Myo9a	C	T	9: 59,790,057	Q374*	probably null	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Ncapg	T	C	5: 45,693,236	L728P	probably damaging	Het
Nfxl1	A	C	5: 72,541,019	F228V	probably benign	Het
Oc90	A	G	15: 65,889,711	S153P	probably damaging	Het
Olfr1458	A	G	19: 13,102,381	*308Q	probably null	Het
Pbk	A	T	14: 65,815,253	K182*	probably null	Het
Piezo1	A	G	8: 122,501,657	F296S	possibly damaging	Het
Psmg1	T	A	16: 95,980,044	Y288F	probably damaging	Het
Rab11fip4	G	A	11: 79,683,480	D132N	probably damaging	Het
Recql4	T	C	15: 76,704,587	D1051G	probably damaging	Het
Reep5	A	C	18: 34,357,131	D104E	probably damaging	Het
Rnpepl1	T	C	1: 92,917,681	Y441H	probably damaging	Het
Scnm1	T	C	3: 95,130,285	I157V	probably benign	Het
Sema3b	T	C	9: 107,600,848	D446G	probably damaging	Het
Sema4d	C	T	13: 51,713,745	R190Q	probably damaging	Het
Slco3a1	G	A	7: 74,318,590	R461C	possibly damaging	Het
Tcrg-C3	T	C	13: 19,263,284	S136P	probably damaging	Het
Tenm2	T	A	11: 36,008,646	I2562F	possibly damaging	Het
Thegl	T	A	5: 77,061,305	V458E	probably benign	Het
Tmem40	G	T	6: 115,733,667	N120K	possibly damaging	Het
Tmod3	T	C	9: 75,500,123	H351R	probably benign	Het
Tnn	C	T	1: 160,086,120	V1268M	probably damaging	Het
Tpmt	T	A	13: 47,035,030	D132V	probably damaging	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Tsen2	A	G	6: 115,560,075	E264G	probably benign	Het
Urah	A	G	7: 140,836,798	I60M	probably benign	Het
Vmn2r26	T	A	6: 124,039,560	S328T	possibly damaging	Het
Vmn2r27	G	C	6: 124,191,999	T724R	probably damaging	Het
Washc2	A	G	6: 116,256,216		probably null	Het
Wdyhv1	C	A	15: 58,150,628	A71E	probably damaging	Het
Zfp955b	T	A	17: 33,302,504	W316R	probably benign	Het
Zranb2	T	C	3: 157,543,246		probably null	Het

Other mutations in Olfr1230

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Olfr1230	APN	2	89296455	missense	probably benign	0.40
IGL01419:Olfr1230	APN	2	89296345	unclassified	probably benign
IGL01644:Olfr1230	APN	2	89296632	missense	probably benign	0.01
IGL01653:Olfr1230	APN	2	89297127	missense	probably benign	0.08
IGL01674:Olfr1230	APN	2	89296670	missense	probably damaging	1.00
IGL02124:Olfr1230	APN	2	89297063	missense	probably benign	0.01
IGL03053:Olfr1230	APN	2	89296445	missense	probably damaging	0.97
R0504:Olfr1230	UTSW	2	89296739	missense	probably damaging	0.99
R1473:Olfr1230	UTSW	2	89296906	nonsense	probably null
R1742:Olfr1230	UTSW	2	89296424	missense	probably damaging	1.00
R1899:Olfr1230	UTSW	2	89296670	missense	probably damaging	1.00
R1900:Olfr1230	UTSW	2	89296670	missense	probably damaging	1.00
R1945:Olfr1230	UTSW	2	89296784	missense	probably damaging	1.00
R2935:Olfr1230	UTSW	2	89297260	missense	possibly damaging	0.69
R3421:Olfr1230	UTSW	2	89296553	missense	probably benign	0.03
R5185:Olfr1230	UTSW	2	89296387	missense	probably benign
R5377:Olfr1230	UTSW	2	89297162	missense	probably damaging	0.99
R5400:Olfr1230	UTSW	2	89296913	missense	probably damaging	1.00
R6083:Olfr1230	UTSW	2	89297024	missense	probably damaging	1.00
R6155:Olfr1230	UTSW	2	89296421	missense	probably damaging	1.00
R6218:Olfr1230	UTSW	2	89296962	missense	probably damaging	0.98
R6361:Olfr1230	UTSW	2	89296646	missense	probably damaging	0.98
R8053:Olfr1230	UTSW	2	89297196	missense	possibly damaging	0.69
R8905:Olfr1230	UTSW	2	89296457	missense	possibly damaging	0.89
Z1176:Olfr1230	UTSW	2	89296953	missense	probably damaging	1.00
Z1177:Olfr1230	UTSW	2	89296452	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- AGAGCTAGGATATGGGTGTCC -3'
(R):5'- CGAATCTGAGGTCTCCCATG -3'

Posted On

2017-07-14