Incidental Mutation 'R6086:Ncapg'
ID 482469
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Name non-SMC condensin I complex, subunit G
Synonyms 5730507H05Rik, MFT.M05.13, Hcapg
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R6086 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 45669919-45700546 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45693236 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 728 (L728P)
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045586] [ENSMUST00000117396] [ENSMUST00000190036]
AlphaFold E9PWG6
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117396
AA Change: L728P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: L728P

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134309
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198274
Meta Mutation Damage Score 0.4088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45693160 missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45695765 missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45676585 splice site probably null
IGL00916:Ncapg APN 5 45671192 missense probably benign 0.37
IGL01293:Ncapg APN 5 45681854 missense probably benign 0.01
IGL01360:Ncapg APN 5 45674385 nonsense probably null
IGL01462:Ncapg APN 5 45671135 missense probably benign 0.02
IGL01527:Ncapg APN 5 45672384 missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45693853 missense probably damaging 1.00
IGL01788:Ncapg APN 5 45671081 missense probably damaging 0.97
IGL01871:Ncapg APN 5 45688581 missense probably benign 0.09
IGL03106:Ncapg APN 5 45695668 missense probably damaging 1.00
IGL03124:Ncapg APN 5 45671209 missense probably benign
R0086:Ncapg UTSW 5 45676744 splice site probably null
R0109:Ncapg UTSW 5 45693748 splice site probably null
R0110:Ncapg UTSW 5 45693147 unclassified probably benign
R0377:Ncapg UTSW 5 45693817 missense probably benign
R0432:Ncapg UTSW 5 45672428 missense probably damaging 0.99
R0637:Ncapg UTSW 5 45687324 missense probably damaging 1.00
R0835:Ncapg UTSW 5 45681448 missense probably damaging 0.96
R0894:Ncapg UTSW 5 45679894 missense probably null 0.24
R1069:Ncapg UTSW 5 45675930 intron probably benign
R1216:Ncapg UTSW 5 45699919 missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45699910 missense probably damaging 0.99
R2396:Ncapg UTSW 5 45678373 missense probably benign 0.00
R3157:Ncapg UTSW 5 45676058 missense probably benign
R3735:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3736:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3887:Ncapg UTSW 5 45674363 missense probably benign
R4371:Ncapg UTSW 5 45678455 missense probably benign
R4545:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4546:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4558:Ncapg UTSW 5 45676644 missense probably benign 0.00
R4615:Ncapg UTSW 5 45687399 missense probably benign 0.00
R4938:Ncapg UTSW 5 45671209 missense probably benign
R5839:Ncapg UTSW 5 45672278 missense probably damaging 0.99
R5871:Ncapg UTSW 5 45695697 missense probably damaging 1.00
R6418:Ncapg UTSW 5 45681816 missense probably damaging 1.00
R6617:Ncapg UTSW 5 45670132 missense probably benign 0.03
R7145:Ncapg UTSW 5 45670030 missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45695793 missense probably benign 0.00
R7443:Ncapg UTSW 5 45672310 missense probably benign 0.31
R7463:Ncapg UTSW 5 45694092 splice site probably null
R7509:Ncapg UTSW 5 45696108 missense probably benign 0.01
R7687:Ncapg UTSW 5 45699885 missense probably benign 0.03
R7919:Ncapg UTSW 5 45696048 missense probably benign 0.00
R8022:Ncapg UTSW 5 45681794 missense probably damaging 1.00
R8177:Ncapg UTSW 5 45693753 missense probably benign 0.00
R8261:Ncapg UTSW 5 45687388 missense possibly damaging 0.90
R8263:Ncapg UTSW 5 45691792 missense probably benign 0.44
R8324:Ncapg UTSW 5 45695668 missense probably damaging 1.00
R8333:Ncapg UTSW 5 45674463 missense probably damaging 0.96
R8742:Ncapg UTSW 5 45693874 missense probably damaging 1.00
R9026:Ncapg UTSW 5 45695773 missense probably benign 0.00
R9051:Ncapg UTSW 5 45695798 missense probably damaging 1.00
R9076:Ncapg UTSW 5 45676641 missense probably benign
R9122:Ncapg UTSW 5 45688673 missense possibly damaging 0.95
R9751:Ncapg UTSW 5 45693853 missense probably damaging 1.00
R9776:Ncapg UTSW 5 45672492 missense probably damaging 0.96
RF019:Ncapg UTSW 5 45698856 missense probably benign 0.00
Z1088:Ncapg UTSW 5 45679880 missense probably damaging 1.00
Z1177:Ncapg UTSW 5 45672502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACTGTTCATTGCAATCCC -3'
(R):5'- CCGAGACATAGTTCAGGTGG -3'

Posted On 2017-07-14