Incidental Mutation 'R6086:Ncapg'
ID 482469
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Name non-SMC condensin I complex, subunit G
Synonyms MFT.M05.13, Hcapg, 5730507H05Rik
MMRRC Submission 044427-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R6086 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 45827261-45857888 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45850578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 728 (L728P)
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045586] [ENSMUST00000117396] [ENSMUST00000190036]
AlphaFold E9PWG6
Predicted Effect probably benign
Transcript: ENSMUST00000045586
SMART Domains Protein: ENSMUSP00000042677
Gene: ENSMUSG00000015882

DomainStartEndE-ValueType
low complexity region 234 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117396
AA Change: L728P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: L728P

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134309
Predicted Effect probably benign
Transcript: ENSMUST00000190036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198274
Meta Mutation Damage Score 0.4088 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob G T 12: 8,065,164 (GRCm39) K4044N probably benign Het
Asic4 G A 1: 75,449,887 (GRCm39) V468I possibly damaging Het
Atf4 T A 15: 80,141,654 (GRCm39) V348D probably benign Het
Bcl9 A G 3: 97,112,840 (GRCm39) V1205A possibly damaging Het
Bora A T 14: 99,299,730 (GRCm39) Q234L possibly damaging Het
Cap2 C A 13: 46,789,188 (GRCm39) P131Q probably damaging Het
Cdyl2 A G 8: 117,316,035 (GRCm39) S318P probably damaging Het
Ces1a T G 8: 93,753,981 (GRCm39) N341H probably benign Het
Cimap2 T C 4: 106,470,403 (GRCm39) E218G probably damaging Het
Crlf3 C T 11: 79,939,436 (GRCm39) V352M possibly damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyren A G 6: 34,851,555 (GRCm39) S127P probably damaging Het
Dnah2 T C 11: 69,406,834 (GRCm39) T529A probably benign Het
Dnah9 C T 11: 65,880,741 (GRCm39) D2619N probably damaging Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Dnajc6 C T 4: 101,455,004 (GRCm39) S65L probably benign Het
Dnm3 C A 1: 162,148,602 (GRCm39) R256S probably damaging Het
Enpp2 T C 15: 54,709,230 (GRCm39) D795G probably damaging Het
Fah A T 7: 84,238,120 (GRCm39) W367R probably damaging Het
Fam220a T A 5: 143,548,796 (GRCm39) H69Q probably benign Het
Fgd3 T A 13: 49,440,772 (GRCm39) T220S probably benign Het
Furin G T 7: 80,045,179 (GRCm39) H248Q probably damaging Het
Gabrg1 A T 5: 70,911,396 (GRCm39) L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,494,148 (GRCm39) probably null Het
Gm9742 T C 13: 8,080,069 (GRCm39) noncoding transcript Het
Gpcpd1 A G 2: 132,380,034 (GRCm39) S252P probably damaging Het
Hnrnpdl C T 5: 100,184,340 (GRCm39) G398S probably null Het
Hspa1l T C 17: 35,197,131 (GRCm39) V390A possibly damaging Het
Htr3b T C 9: 48,858,598 (GRCm39) S94G probably benign Het
Klf10 G T 15: 38,297,181 (GRCm39) S271R probably benign Het
Klk1b3 T A 7: 43,851,158 (GRCm39) L197Q probably damaging Het
Knl1 A G 2: 118,924,549 (GRCm39) R1861G probably damaging Het
Myo9a C T 9: 59,697,340 (GRCm39) Q374* probably null Het
Myt1l G A 12: 29,882,331 (GRCm39) G509R unknown Het
Nfxl1 A C 5: 72,698,362 (GRCm39) F228V probably benign Het
Ntaq1 C A 15: 58,014,024 (GRCm39) A71E probably damaging Het
Oc90 A G 15: 65,761,560 (GRCm39) S153P probably damaging Het
Or4c123 A G 2: 89,127,198 (GRCm39) C139R probably damaging Het
Or5b105 A G 19: 13,079,745 (GRCm39) *308Q probably null Het
Pbk A T 14: 66,052,702 (GRCm39) K182* probably null Het
Piezo1 A G 8: 123,228,396 (GRCm39) F296S possibly damaging Het
Psmg1 T A 16: 95,781,244 (GRCm39) Y288F probably damaging Het
Rab11fip4 G A 11: 79,574,306 (GRCm39) D132N probably damaging Het
Recql4 T C 15: 76,588,787 (GRCm39) D1051G probably damaging Het
Reep5 A C 18: 34,490,184 (GRCm39) D104E probably damaging Het
Rnpepl1 T C 1: 92,845,403 (GRCm39) Y441H probably damaging Het
Scnm1 T C 3: 95,037,596 (GRCm39) I157V probably benign Het
Sema3b T C 9: 107,478,047 (GRCm39) D446G probably damaging Het
Sema4d C T 13: 51,867,781 (GRCm39) R190Q probably damaging Het
Slco3a1 G A 7: 73,968,338 (GRCm39) R461C possibly damaging Het
Spmap2l T A 5: 77,209,152 (GRCm39) V458E probably benign Het
Tenm2 T A 11: 35,899,473 (GRCm39) I2562F possibly damaging Het
Tmem40 G T 6: 115,710,628 (GRCm39) N120K possibly damaging Het
Tmod3 T C 9: 75,407,405 (GRCm39) H351R probably benign Het
Tnn C T 1: 159,913,690 (GRCm39) V1268M probably damaging Het
Tpmt T A 13: 47,188,506 (GRCm39) D132V probably damaging Het
Trgc3 T C 13: 19,447,454 (GRCm39) S136P probably damaging Het
Trib1 G A 15: 59,526,324 (GRCm39) R298H probably damaging Het
Tsen2 A G 6: 115,537,036 (GRCm39) E264G probably benign Het
Urah A G 7: 140,416,711 (GRCm39) I60M probably benign Het
Vmn2r26 T A 6: 124,016,519 (GRCm39) S328T possibly damaging Het
Vmn2r27 G C 6: 124,168,958 (GRCm39) T724R probably damaging Het
Washc2 A G 6: 116,233,177 (GRCm39) probably null Het
Zfp955b T A 17: 33,521,478 (GRCm39) W316R probably benign Het
Zranb2 T C 3: 157,248,883 (GRCm39) probably null Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45,850,502 (GRCm39) missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45,853,107 (GRCm39) missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45,833,927 (GRCm39) splice site probably null
IGL00916:Ncapg APN 5 45,828,534 (GRCm39) missense probably benign 0.37
IGL01293:Ncapg APN 5 45,839,196 (GRCm39) missense probably benign 0.01
IGL01360:Ncapg APN 5 45,831,727 (GRCm39) nonsense probably null
IGL01462:Ncapg APN 5 45,828,477 (GRCm39) missense probably benign 0.02
IGL01527:Ncapg APN 5 45,829,726 (GRCm39) missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45,851,195 (GRCm39) missense probably damaging 1.00
IGL01788:Ncapg APN 5 45,828,423 (GRCm39) missense probably damaging 0.97
IGL01871:Ncapg APN 5 45,845,923 (GRCm39) missense probably benign 0.09
IGL03106:Ncapg APN 5 45,853,010 (GRCm39) missense probably damaging 1.00
IGL03124:Ncapg APN 5 45,828,551 (GRCm39) missense probably benign
R0086:Ncapg UTSW 5 45,834,086 (GRCm39) splice site probably null
R0109:Ncapg UTSW 5 45,851,090 (GRCm39) splice site probably null
R0110:Ncapg UTSW 5 45,850,489 (GRCm39) unclassified probably benign
R0377:Ncapg UTSW 5 45,851,159 (GRCm39) missense probably benign
R0432:Ncapg UTSW 5 45,829,770 (GRCm39) missense probably damaging 0.99
R0637:Ncapg UTSW 5 45,844,666 (GRCm39) missense probably damaging 1.00
R0835:Ncapg UTSW 5 45,838,790 (GRCm39) missense probably damaging 0.96
R0894:Ncapg UTSW 5 45,837,236 (GRCm39) missense probably null 0.24
R1069:Ncapg UTSW 5 45,833,272 (GRCm39) intron probably benign
R1216:Ncapg UTSW 5 45,857,261 (GRCm39) missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45,857,252 (GRCm39) missense probably damaging 0.99
R2396:Ncapg UTSW 5 45,835,715 (GRCm39) missense probably benign 0.00
R3157:Ncapg UTSW 5 45,833,400 (GRCm39) missense probably benign
R3735:Ncapg UTSW 5 45,853,469 (GRCm39) missense probably benign 0.00
R3736:Ncapg UTSW 5 45,853,469 (GRCm39) missense probably benign 0.00
R3887:Ncapg UTSW 5 45,831,705 (GRCm39) missense probably benign
R4371:Ncapg UTSW 5 45,835,797 (GRCm39) missense probably benign
R4545:Ncapg UTSW 5 45,828,554 (GRCm39) missense probably damaging 1.00
R4546:Ncapg UTSW 5 45,828,554 (GRCm39) missense probably damaging 1.00
R4558:Ncapg UTSW 5 45,833,986 (GRCm39) missense probably benign 0.00
R4615:Ncapg UTSW 5 45,844,741 (GRCm39) missense probably benign 0.00
R4938:Ncapg UTSW 5 45,828,551 (GRCm39) missense probably benign
R5839:Ncapg UTSW 5 45,829,620 (GRCm39) missense probably damaging 0.99
R5871:Ncapg UTSW 5 45,853,039 (GRCm39) missense probably damaging 1.00
R6418:Ncapg UTSW 5 45,839,158 (GRCm39) missense probably damaging 1.00
R6617:Ncapg UTSW 5 45,827,474 (GRCm39) missense probably benign 0.03
R7145:Ncapg UTSW 5 45,827,372 (GRCm39) missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45,853,135 (GRCm39) missense probably benign 0.00
R7443:Ncapg UTSW 5 45,829,652 (GRCm39) missense probably benign 0.31
R7463:Ncapg UTSW 5 45,851,434 (GRCm39) splice site probably null
R7509:Ncapg UTSW 5 45,853,450 (GRCm39) missense probably benign 0.01
R7687:Ncapg UTSW 5 45,857,227 (GRCm39) missense probably benign 0.03
R7919:Ncapg UTSW 5 45,853,390 (GRCm39) missense probably benign 0.00
R8022:Ncapg UTSW 5 45,839,136 (GRCm39) missense probably damaging 1.00
R8177:Ncapg UTSW 5 45,851,095 (GRCm39) missense probably benign 0.00
R8261:Ncapg UTSW 5 45,844,730 (GRCm39) missense possibly damaging 0.90
R8263:Ncapg UTSW 5 45,849,134 (GRCm39) missense probably benign 0.44
R8324:Ncapg UTSW 5 45,853,010 (GRCm39) missense probably damaging 1.00
R8333:Ncapg UTSW 5 45,831,805 (GRCm39) missense probably damaging 0.96
R8742:Ncapg UTSW 5 45,851,216 (GRCm39) missense probably damaging 1.00
R9026:Ncapg UTSW 5 45,853,115 (GRCm39) missense probably benign 0.00
R9051:Ncapg UTSW 5 45,853,140 (GRCm39) missense probably damaging 1.00
R9076:Ncapg UTSW 5 45,833,983 (GRCm39) missense probably benign
R9122:Ncapg UTSW 5 45,846,015 (GRCm39) missense possibly damaging 0.95
R9751:Ncapg UTSW 5 45,851,195 (GRCm39) missense probably damaging 1.00
R9776:Ncapg UTSW 5 45,829,834 (GRCm39) missense probably damaging 0.96
RF019:Ncapg UTSW 5 45,856,198 (GRCm39) missense probably benign 0.00
Z1088:Ncapg UTSW 5 45,837,222 (GRCm39) missense probably damaging 1.00
Z1177:Ncapg UTSW 5 45,829,844 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACTGTTCATTGCAATCCC -3'
(R):5'- CCGAGACATAGTTCAGGTGG -3'

Posted On 2017-07-14