Incidental Mutation 'R6086:Sema3b'
ID482491
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
SynonymsSemA, sema5, semaV, Semaa, LUCA-1, SemA
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R6086 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107597674-107609229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107600848 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 446 (D446G)
Ref Sequence ENSEMBL: ENSMUSP00000099591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000193180] [ENSMUST00000194433] [ENSMUST00000194606] [ENSMUST00000195662] [ENSMUST00000195057]
Predicted Effect probably damaging
Transcript: ENSMUST00000073448
AA Change: D446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102529
AA Change: D446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102530
AA Change: D446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102531
AA Change: D446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102532
AA Change: D446G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123926
AA Change: D446G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: D446G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191791
Predicted Effect probably benign
Transcript: ENSMUST00000193180
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193551
Predicted Effect probably benign
Transcript: ENSMUST00000194433
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195472
Predicted Effect probably benign
Transcript: ENSMUST00000195662
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Meta Mutation Damage Score 0.8291 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107604041 critical splice donor site probably null
IGL02750:Sema3b APN 9 107603164 missense probably benign 0.02
IGL02878:Sema3b APN 9 107600993 missense probably damaging 0.97
IGL03004:Sema3b APN 9 107602915 missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107602063 missense probably damaging 1.00
IGL03129:Sema3b APN 9 107599796 unclassified probably benign
IGL03334:Sema3b APN 9 107604077 missense probably damaging 1.00
R0373:Sema3b UTSW 9 107602918 missense probably benign 0.05
R0384:Sema3b UTSW 9 107600966 missense probably damaging 1.00
R0883:Sema3b UTSW 9 107604156 missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107600458 missense probably damaging 1.00
R3971:Sema3b UTSW 9 107600368 missense probably benign
R4212:Sema3b UTSW 9 107603398 missense probably damaging 1.00
R4647:Sema3b UTSW 9 107599051 missense possibly damaging 0.79
R4694:Sema3b UTSW 9 107605002 missense probably benign 0.03
R4791:Sema3b UTSW 9 107603813 missense probably damaging 1.00
R4853:Sema3b UTSW 9 107602067 splice site probably null
R5305:Sema3b UTSW 9 107603337 missense probably null 1.00
R5487:Sema3b UTSW 9 107600962 missense probably damaging 1.00
R5745:Sema3b UTSW 9 107601429 missense probably damaging 0.98
R5751:Sema3b UTSW 9 107599714 missense probably benign
R6306:Sema3b UTSW 9 107600920 missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107598826 missense probably benign 0.01
R6816:Sema3b UTSW 9 107600350 missense probably benign 0.08
R6833:Sema3b UTSW 9 107603316 missense probably benign 0.04
R7320:Sema3b UTSW 9 107600942 missense probably benign
R7448:Sema3b UTSW 9 107602963 missense probably damaging 1.00
R7687:Sema3b UTSW 9 107603814 missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107599034 splice site probably null
Z1176:Sema3b UTSW 9 107599639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTTGAAACAATGACCAGAGCC -3'
(R):5'- TGTATCTCTGCCTGACGCAC -3'

Posted On2017-07-14