Incidental Mutation 'R6086:Zfp955b'
ID 482517
Institutional Source Beutler Lab
Gene Symbol Zfp955b
Ensembl Gene ENSMUSG00000096910
Gene Name zinc finger protein 955B
Synonyms A430003O12Rik, C430039G02Rik, Gm4455
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6086 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 33289649-33303196 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33302504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 316 (W316R)
Ref Sequence ENSEMBL: ENSMUSP00000097011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099414]
AlphaFold L7N232
Predicted Effect probably benign
Transcript: ENSMUST00000099414
AA Change: W316R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097011
Gene: ENSMUSG00000096910
AA Change: W316R

DomainStartEndE-ValueType
KRAB 10 70 3.04e-14 SMART
ZnF_C2H2 230 252 7.68e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.75e0 SMART
ZnF_C2H2 318 340 5.81e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 7.78e-3 SMART
ZnF_C2H2 430 452 3.16e-3 SMART
ZnF_C2H2 458 480 1.1e-2 SMART
ZnF_C2H2 486 508 2.09e-3 SMART
ZnF_C2H2 514 536 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Hspa1l T C 17: 34,978,155 V390A possibly damaging Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Zfp955b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zfp955b APN 17 33302873 missense probably damaging 1.00
IGL02073:Zfp955b APN 17 33300590 missense possibly damaging 0.69
IGL02126:Zfp955b APN 17 33302264 nonsense probably null
IGL02237:Zfp955b APN 17 33301919 missense probably damaging 1.00
IGL02587:Zfp955b APN 17 33300650 missense probably damaging 1.00
IGL02971:Zfp955b APN 17 33300966 missense probably benign 0.11
IGL03034:Zfp955b APN 17 33302168 missense probably benign 0.22
IGL03493:Zfp955b APN 17 33302545 missense probably benign 0.35
R0269:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0373:Zfp955b UTSW 17 33302522 missense probably benign
R0617:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0684:Zfp955b UTSW 17 33302973 missense probably benign 0.00
R1778:Zfp955b UTSW 17 33302814 missense probably benign 0.07
R1874:Zfp955b UTSW 17 33305453 missense probably benign 0.10
R3893:Zfp955b UTSW 17 33302994 missense probably benign 0.01
R3938:Zfp955b UTSW 17 33305416 missense probably damaging 1.00
R4082:Zfp955b UTSW 17 33302155 missense probably benign 0.08
R4672:Zfp955b UTSW 17 33305259 unclassified probably benign
R4956:Zfp955b UTSW 17 33305235 unclassified probably benign
R4998:Zfp955b UTSW 17 33305151 unclassified probably benign
R5276:Zfp955b UTSW 17 33303057 missense probably damaging 1.00
R5341:Zfp955b UTSW 17 33305121 unclassified probably benign
R5558:Zfp955b UTSW 17 33302187 missense possibly damaging 0.88
R6170:Zfp955b UTSW 17 33302110 missense probably benign 0.00
R6306:Zfp955b UTSW 17 33303186 missense probably benign 0.07
R6519:Zfp955b UTSW 17 33302077 missense possibly damaging 0.55
R9286:Zfp955b UTSW 17 33302709 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATGTAGACACTGTGGTGAAAC -3'
(R):5'- ATGGTTGGAACAGTTGCCC -3'

Posted On 2017-07-14