Incidental Mutation 'R6086:Hspa1l'
ID482518
Institutional Source Beutler Lab
Gene Symbol Hspa1l
Ensembl Gene ENSMUSG00000007033
Gene Nameheat shock protein 1-like
Synonyms70kDa, Msh5, Hsc70t
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R6086 (G1)
Quality Score224.009
Status Validated
Chromosome17
Chromosomal Location34972703-34979285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34978155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 390 (V390A)
Ref Sequence ENSEMBL: ENSMUSP00000007248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007248] [ENSMUST00000007266] [ENSMUST00000114011] [ENSMUST00000173004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007248
AA Change: V390A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007248
Gene: ENSMUSG00000007033
AA Change: V390A

DomainStartEndE-ValueType
Pfam:HSP70 8 614 6.5e-269 PFAM
low complexity region 616 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000007266
SMART Domains Protein: ENSMUSP00000007266
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 41 108 8.91e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114011
SMART Domains Protein: ENSMUSP00000109644
Gene: ENSMUSG00000007050

DomainStartEndE-ValueType
Sm 5 72 8.91e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172890
Predicted Effect probably benign
Transcript: ENSMUST00000173004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174860
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110062M04Rik A G 6: 34,874,620 S127P probably damaging Het
Apob G T 12: 8,015,164 K4044N probably benign Het
Asic4 G A 1: 75,473,243 V468I possibly damaging Het
Atf4 T A 15: 80,257,453 V348D probably benign Het
Bcl9 A G 3: 97,205,524 V1205A possibly damaging Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Cap2 C A 13: 46,635,712 P131Q probably damaging Het
Cdyl2 A G 8: 116,589,296 S318P probably damaging Het
Ces1a T G 8: 93,027,353 N341H probably benign Het
Crlf3 C T 11: 80,048,610 V352M possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah2 T C 11: 69,516,008 T529A probably benign Het
Dnah9 C T 11: 65,989,915 D2619N probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnajc6 C T 4: 101,597,807 S65L probably benign Het
Dnm3 C A 1: 162,321,033 R256S probably damaging Het
Enpp2 T C 15: 54,845,834 D795G probably damaging Het
Fah A T 7: 84,588,912 W367R probably damaging Het
Fam220a T A 5: 143,563,041 H69Q probably benign Het
Fgd3 T A 13: 49,287,296 T220S probably benign Het
Furin G T 7: 80,395,431 H248Q probably damaging Het
Gabrg1 A T 5: 70,754,053 L410Q probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm9742 T C 13: 8,030,033 noncoding transcript Het
Gpcpd1 A G 2: 132,538,114 S252P probably damaging Het
Hnrnpdl C T 5: 100,036,481 G398S probably null Het
Htr3b T C 9: 48,947,298 S94G probably benign Het
Klf10 G T 15: 38,296,937 S271R probably benign Het
Klk1b3 T A 7: 44,201,734 L197Q probably damaging Het
Knl1 A G 2: 119,094,068 R1861G probably damaging Het
Lexm T C 4: 106,613,206 E218G probably damaging Het
Myo9a C T 9: 59,790,057 Q374* probably null Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Ncapg T C 5: 45,693,236 L728P probably damaging Het
Nfxl1 A C 5: 72,541,019 F228V probably benign Het
Oc90 A G 15: 65,889,711 S153P probably damaging Het
Olfr1230 A G 2: 89,296,854 C139R probably damaging Het
Olfr1458 A G 19: 13,102,381 *308Q probably null Het
Pbk A T 14: 65,815,253 K182* probably null Het
Piezo1 A G 8: 122,501,657 F296S possibly damaging Het
Psmg1 T A 16: 95,980,044 Y288F probably damaging Het
Rab11fip4 G A 11: 79,683,480 D132N probably damaging Het
Recql4 T C 15: 76,704,587 D1051G probably damaging Het
Reep5 A C 18: 34,357,131 D104E probably damaging Het
Rnpepl1 T C 1: 92,917,681 Y441H probably damaging Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sema3b T C 9: 107,600,848 D446G probably damaging Het
Sema4d C T 13: 51,713,745 R190Q probably damaging Het
Slco3a1 G A 7: 74,318,590 R461C possibly damaging Het
Tcrg-C3 T C 13: 19,263,284 S136P probably damaging Het
Tenm2 T A 11: 36,008,646 I2562F possibly damaging Het
Thegl T A 5: 77,061,305 V458E probably benign Het
Tmem40 G T 6: 115,733,667 N120K possibly damaging Het
Tmod3 T C 9: 75,500,123 H351R probably benign Het
Tnn C T 1: 160,086,120 V1268M probably damaging Het
Tpmt T A 13: 47,035,030 D132V probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Tsen2 A G 6: 115,560,075 E264G probably benign Het
Urah A G 7: 140,836,798 I60M probably benign Het
Vmn2r26 T A 6: 124,039,560 S328T possibly damaging Het
Vmn2r27 G C 6: 124,191,999 T724R probably damaging Het
Washc2 A G 6: 116,256,216 probably null Het
Wdyhv1 C A 15: 58,150,628 A71E probably damaging Het
Zfp955b T A 17: 33,302,504 W316R probably benign Het
Zranb2 T C 3: 157,543,246 probably null Het
Other mutations in Hspa1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Hspa1l APN 17 34977465 missense probably damaging 1.00
IGL01548:Hspa1l APN 17 34978391 missense probably damaging 0.98
IGL01860:Hspa1l APN 17 34978811 missense probably benign 0.00
IGL01959:Hspa1l APN 17 34977135 missense probably damaging 1.00
IGL02661:Hspa1l APN 17 34977275 missense probably benign
R0355:Hspa1l UTSW 17 34977410 missense probably benign
R0850:Hspa1l UTSW 17 34977623 missense probably benign 0.01
R1675:Hspa1l UTSW 17 34977443 missense probably damaging 1.00
R2148:Hspa1l UTSW 17 34977390 missense probably damaging 0.98
R2169:Hspa1l UTSW 17 34977323 missense probably benign
R2418:Hspa1l UTSW 17 34977188 missense probably benign 0.05
R4323:Hspa1l UTSW 17 34977856 nonsense probably null
R4924:Hspa1l UTSW 17 34977856 nonsense probably null
R4926:Hspa1l UTSW 17 34978223 missense possibly damaging 0.92
R5186:Hspa1l UTSW 17 34978469 missense probably damaging 0.97
R5653:Hspa1l UTSW 17 34977420 missense probably damaging 1.00
R5790:Hspa1l UTSW 17 34977240 missense probably benign 0.08
R6237:Hspa1l UTSW 17 34977452 nonsense probably null
R7229:Hspa1l UTSW 17 34977255 missense probably benign 0.05
Z1176:Hspa1l UTSW 17 34978492 missense possibly damaging 0.52
Z1177:Hspa1l UTSW 17 34978016 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTGTGCAGACCTATTTAGAGGC -3'
(R):5'- TCGTACACCTGGATCAGCAC -3'

Posted On2017-07-14