Incidental Mutation 'R0517:Pros1'
ID 48252
Institutional Source Beutler Lab
Gene Symbol Pros1
Ensembl Gene ENSMUSG00000022912
Gene Name protein S (alpha)
Synonyms protein S
MMRRC Submission 038710-MU
Accession Numbers

Genbank: NM_011173; MGI: 1095733  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0517 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 62854307-62929346 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62903518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 210 (S210G)
Ref Sequence ENSEMBL: ENSMUSP00000023629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023629]
AlphaFold Q08761
Predicted Effect probably benign
Transcript: ENSMUST00000023629
AA Change: S210G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: S210G

DomainStartEndE-ValueType
GLA 23 86 3.63e-31 SMART
EGF 120 155 4.39e-2 SMART
EGF_CA 157 200 6.91e-9 SMART
EGF_CA 201 242 5.23e-9 SMART
EGF_CA 243 283 1.1e-7 SMART
LamG 321 458 8.55e-22 SMART
LamG 506 646 1.57e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155940
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Vmn2r120 T C 17: 57,508,949 Y802C probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Pros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Pros1 APN 16 62910045 missense probably damaging 0.99
IGL01300:Pros1 APN 16 62913811 missense possibly damaging 0.85
IGL02709:Pros1 APN 16 62898945 missense probably damaging 0.99
IGL03080:Pros1 APN 16 62918143 missense probably damaging 0.98
IGL03095:Pros1 APN 16 62907769 nonsense probably null
F6893:Pros1 UTSW 16 62924639 missense probably damaging 0.98
R0124:Pros1 UTSW 16 62913946 missense possibly damaging 0.95
R1113:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1308:Pros1 UTSW 16 62913865 missense probably damaging 0.99
R1355:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1370:Pros1 UTSW 16 62919558 missense probably benign 0.23
R1517:Pros1 UTSW 16 62885512 missense probably damaging 0.98
R1866:Pros1 UTSW 16 62928135 missense possibly damaging 0.86
R1876:Pros1 UTSW 16 62903518 missense probably damaging 0.96
R2255:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R2364:Pros1 UTSW 16 62913848 missense probably damaging 0.99
R2369:Pros1 UTSW 16 62928069 missense probably damaging 1.00
R2979:Pros1 UTSW 16 62913866 missense probably damaging 0.99
R3724:Pros1 UTSW 16 62900329 missense possibly damaging 0.86
R4056:Pros1 UTSW 16 62900645 nonsense probably null
R4556:Pros1 UTSW 16 62900673 missense possibly damaging 0.95
R4688:Pros1 UTSW 16 62889007 critical splice donor site probably null
R4850:Pros1 UTSW 16 62885524 missense probably damaging 0.98
R4923:Pros1 UTSW 16 62903572 missense possibly damaging 0.86
R5008:Pros1 UTSW 16 62928185 missense possibly damaging 0.53
R5370:Pros1 UTSW 16 62913976 missense probably benign 0.01
R5580:Pros1 UTSW 16 62926326 critical splice acceptor site probably null
R5930:Pros1 UTSW 16 62928061 missense probably damaging 0.96
R5974:Pros1 UTSW 16 62900667 missense probably damaging 0.98
R6233:Pros1 UTSW 16 62898921 missense possibly damaging 0.47
R6949:Pros1 UTSW 16 62924575 missense probably benign 0.01
R7055:Pros1 UTSW 16 62928102 missense possibly damaging 0.85
R7347:Pros1 UTSW 16 62919523 missense probably damaging 0.97
R7375:Pros1 UTSW 16 62924550 missense probably damaging 0.96
R7419:Pros1 UTSW 16 62928070 nonsense probably null
R7980:Pros1 UTSW 16 62928153 missense possibly damaging 0.86
R8234:Pros1 UTSW 16 62928177 missense possibly damaging 0.73
R8479:Pros1 UTSW 16 62907739 missense probably damaging 1.00
R8514:Pros1 UTSW 16 62910109 missense probably benign 0.03
R8827:Pros1 UTSW 16 62926464 missense probably benign 0.13
R9131:Pros1 UTSW 16 62928034 missense probably damaging 0.96
R9484:Pros1 UTSW 16 62924524 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAGGCACATTAGGCAAACTTCCCAT -3'
(R):5'- CAAGCTGCATCAGGGGTTAGCAAA -3'

Sequencing Primer
(F):5'- CTGTGCTCTTCCAAGACTGTTGA -3'
(R):5'- GCAAAAGTATTGCTTTGTCTGC -3'
Posted On 2013-06-12