Mutagenetix > Incidental Mutation

Incidental Mutation 'R0517:Pros1'

48252

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

038710-MU

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0517 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62903518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 210 (S210G)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

probably benign
Transcript: ENSMUST00000023629
AA Change: S210G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: S210G

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155940

Meta Mutation Damage Score

0.0910

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	T	A	17: 36,981,132		probably benign	Het
Acer1	T	C	17: 56,955,569	T194A	probably benign	Het
Adamts1	C	A	16: 85,800,353	D10Y	possibly damaging	Het
Adamts7	T	C	9: 90,199,858	V1612A	probably benign	Het
Adcyap1r1	T	A	6: 55,491,297	S373T	probably damaging	Het
Armc4	A	C	18: 7,223,621	L474R	probably damaging	Het
Asic5	A	T	3: 82,009,526	I266F	probably benign	Het
Cacna1d	A	T	14: 30,179,275	I274K	probably damaging	Het
Camsap2	G	T	1: 136,293,388	Q238K	possibly damaging	Het
Ceacam15	A	C	7: 16,673,520	L24*	probably null	Het
Cerk	G	A	15: 86,156,648	T170I	probably damaging	Het
Cyp27b1	T	C	10: 127,050,116		probably null	Het
Cyp2c65	T	C	19: 39,082,348		probably benign	Het
Dennd5a	A	G	7: 109,934,761	S75P	probably damaging	Het
Dhx9	C	T	1: 153,478,916	A146T	possibly damaging	Het
Dpysl5	A	G	5: 30,778,066	D171G	probably damaging	Het
Dsg3	A	G	18: 20,529,025	N449S	probably benign	Het
Eps8l3	T	C	3: 107,883,460	S189P	probably benign	Het
Exph5	A	G	9: 53,372,762	E381G	probably benign	Het
Fam208b	T	A	13: 3,566,964	T2367S	possibly damaging	Het
Fbxo46	A	G	7: 19,136,874	M473V	possibly damaging	Het
Fgf14	G	A	14: 123,983,784	P203S	probably damaging	Het
Foxf2	C	T	13: 31,626,243	A55V	unknown	Het
Galnt5	T	G	2: 58,035,373		probably benign	Het
Glis2	T	C	16: 4,611,552	L181P	probably damaging	Het
Gm1000	T	G	12: 104,476,408		probably benign	Het
Helz2	A	G	2: 181,227,770	S2959P	probably benign	Het
Hyal6	A	G	6: 24,734,853	N262D	probably benign	Het
Lgr4	T	C	2: 110,011,320	L526P	probably damaging	Het
Mapk1	A	T	16: 17,016,046	I88F	probably benign	Het
Mpg	A	T	11: 32,231,853	H287L	probably benign	Het
Mpp4	A	T	1: 59,124,727	Y489*	probably null	Het
Mpzl1	T	C	1: 165,601,790	E224G	probably damaging	Het
Myh10	A	G	11: 68,811,599		probably null	Het
Olfr1034	T	C	2: 86,047,204	S241P	probably damaging	Het
Olfr1340	T	A	4: 118,726,634	I129K	probably damaging	Het
Paip1	T	A	13: 119,447,790	F196I	probably damaging	Het
Pde3a	A	T	6: 141,498,657	K1064*	probably null	Het
Pira2	A	T	7: 3,844,197		probably benign	Het
Rbm15	A	T	3: 107,331,369	L571Q	probably damaging	Het
Scn1a	T	A	2: 66,302,407	T1194S	possibly damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Serpina1e	G	A	12: 103,949,227	T240I	probably benign	Het
Setx	T	G	2: 29,157,133	S1874R	probably benign	Het
Sgsm2	G	T	11: 74,867,651	T256K	possibly damaging	Het
Slc44a1	T	C	4: 53,542,366	V300A	probably damaging	Het
Spata46	A	G	1: 170,311,609	Y59C	probably damaging	Het
Supt3	T	C	17: 45,119,271	F404L	probably benign	Het
Tars	T	A	15: 11,394,366	K62*	probably null	Het
Tas2r139	A	C	6: 42,141,491	T186P	probably damaging	Het
Tc2n	C	T	12: 101,649,195	S457N	probably damaging	Het
Tox4	A	T	14: 52,292,628	S582C	probably benign	Het
Trappc12	T	C	12: 28,697,134		probably benign	Het
Ubqlnl	G	T	7: 104,148,638	Q551K	probably damaging	Het
Ubr4	A	G	4: 139,392,124	T205A	probably benign	Het
Urb1	G	A	16: 90,777,422	Q924*	probably null	Het
Vmn1r49	A	G	6: 90,072,738	L94P	probably damaging	Het
Vmn2r120	T	C	17: 57,508,949	Y802C	probably damaging	Het
Xrcc1	C	T	7: 24,570,319		probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8234:Pros1	UTSW	16	62928177	missense	possibly damaging	0.73
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AAGGCACATTAGGCAAACTTCCCAT -3'
(R):5'- CAAGCTGCATCAGGGGTTAGCAAA -3'

Sequencing Primer
(F):5'- CTGTGCTCTTCCAAGACTGTTGA -3'
(R):5'- GCAAAAGTATTGCTTTGTCTGC -3'

Posted On

2013-06-12