Incidental Mutation 'R6072:Tyw1'
ID482532
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6072 (G1)
Quality Score221.009
Status Not validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130267911 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 123 (V123A)
Ref Sequence ENSEMBL: ENSMUSP00000047318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662] [ENSMUST00000147619]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040213
AA Change: V123A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310
AA Change: V123A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000044204
AA Change: V123A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: V123A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100662
AA Change: V123A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310
AA Change: V123A

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147619
AA Change: V100A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123693
Gene: ENSMUSG00000056310
AA Change: V100A

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 50 201 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173375
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 utr 3 prime probably null
R7259:Tyw1 UTSW 5 130267872 intron probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCACTTAGACAACCCTGTTTG -3'
(R):5'- CACCTTGTTGAAGTGGCTCC -3'

Sequencing Primer
(F):5'- AGTTATAGCTGGTTCTGATCCAC -3'
(R):5'- TCCGGTAGGCAGAGTCTC -3'
Posted On2017-07-14