Incidental Mutation 'R6072:Tmem147'
ID482536
Institutional Source Beutler Lab
Gene Symbol Tmem147
Ensembl Gene ENSMUSG00000006315
Gene Nametransmembrane protein 147
Synonyms5033425B17Rik, 2010004E11Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30727701-30729540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30728020 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 99 (M99K)
Ref Sequence ENSEMBL: ENSMUSP00000146893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000208169] [ENSMUST00000209065]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006478
AA Change: M173K

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315
AA Change: M173K

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074758
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165410
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180820
SMART Domains Protein: ENSMUSP00000137757
Gene: ENSMUSG00000097320

DomainStartEndE-ValueType
SCOP:d1i7oa2 53 93 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182634
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183194
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably benign
Transcript: ENSMUST00000207296
AA Change: M180K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207955
Predicted Effect possibly damaging
Transcript: ENSMUST00000208169
AA Change: M99K

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000209065
AA Change: M124K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Tmem147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tmem147 APN 7 30728433 nonsense probably null
IGL02491:Tmem147 APN 7 30728201 splice site probably benign
IGL02971:Tmem147 APN 7 30729422 unclassified probably benign
R0070:Tmem147 UTSW 7 30728101 missense probably damaging 1.00
R0609:Tmem147 UTSW 7 30728102 missense probably benign 0.03
R1167:Tmem147 UTSW 7 30727796 missense probably benign 0.33
R1254:Tmem147 UTSW 7 30729370 nonsense probably null
R5983:Tmem147 UTSW 7 30728059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTCCTGTTACTACTGCC -3'
(R):5'- ATGAGCATTGACTCCAACATCAG -3'

Sequencing Primer
(F):5'- TGTTACTACTGCCCGGGC -3'
(R):5'- ACATCAGTCTGGTATGCAGTCTAGC -3'
Posted On2017-07-14