Incidental Mutation 'R6072:Nosip'
ID482537
Institutional Source Beutler Lab
Gene Symbol Nosip
Ensembl Gene ENSMUSG00000003421
Gene Namenitric oxide synthase interacting protein
Synonyms2310061K06Rik, CGI-25
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6072 (G1)
Quality Score159.009
Status Not validated
Chromosome7
Chromosomal Location45062429-45078210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45076648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 187 (V187M)
Ref Sequence ENSEMBL: ENSMUSP00000103460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003513] [ENSMUST00000107829] [ENSMUST00000210088] [ENSMUST00000210520] [ENSMUST00000211465]
Predicted Effect probably benign
Transcript: ENSMUST00000003513
AA Change: V212M

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003513
Gene: ENSMUSG00000003421
AA Change: V212M

DomainStartEndE-ValueType
Pfam:zf-NOSIP 4 78 1.2e-55 PFAM
coiled coil region 83 108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107829
AA Change: V187M

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103460
Gene: ENSMUSG00000003421
AA Change: V187M

DomainStartEndE-ValueType
SCOP:d1rmd_2 31 79 2e-4 SMART
Blast:RING 46 226 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209901
Predicted Effect probably benign
Transcript: ENSMUST00000210088
Predicted Effect probably benign
Transcript: ENSMUST00000210520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210998
Predicted Effect probably benign
Transcript: ENSMUST00000211465
AA Change: V210M

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may modulate the activity and localization of nitric oxide synthase (endothelial and neuronal) and thus nitric oxide production. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Nosip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Nosip APN 7 45076859 missense probably damaging 1.00
IGL02245:Nosip APN 7 45074042 missense probably benign 0.13
IGL02385:Nosip APN 7 45076732 missense possibly damaging 0.90
IGL02676:Nosip APN 7 45077328 missense probably damaging 1.00
R0295:Nosip UTSW 7 45076916 missense probably damaging 1.00
R1599:Nosip UTSW 7 45074006 missense probably benign 0.02
R1812:Nosip UTSW 7 45076574 missense probably damaging 0.99
R1843:Nosip UTSW 7 45077309 splice site probably null
R2018:Nosip UTSW 7 45076609 missense probably benign
R2359:Nosip UTSW 7 45074026 missense possibly damaging 0.82
R4857:Nosip UTSW 7 45076678 missense probably benign 0.06
R6370:Nosip UTSW 7 45076740 critical splice donor site probably null
X0026:Nosip UTSW 7 45076397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATTCCCTCACTAACGCC -3'
(R):5'- TCTCAACACACTCCAGGGTGAC -3'

Sequencing Primer
(F):5'- AGGGCCCAATGTCCAGGATTC -3'
(R):5'- GGTGACCACAGCCCCACTAC -3'
Posted On2017-07-14