Incidental Mutation 'R6072:1700093K21Rik'
ID482545
Institutional Source Beutler Lab
Gene Symbol 1700093K21Rik
Ensembl Gene ENSMUSG00000020286
Gene NameRIKEN cDNA 1700093K21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6072 (G1)
Quality Score175.009
Status Not validated
Chromosome11
Chromosomal Location23516203-23521155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23517357 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 92 (M92K)
Ref Sequence ENSEMBL: ENSMUSP00000131204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020527] [ENSMUST00000140122] [ENSMUST00000156629] [ENSMUST00000169264]
Predicted Effect probably benign
Transcript: ENSMUST00000020527
AA Change: M92K

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020527
Gene: ENSMUSG00000020286
AA Change: M92K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:DUF4642 50 196 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140122
Predicted Effect probably benign
Transcript: ENSMUST00000156629
Predicted Effect probably benign
Transcript: ENSMUST00000169264
AA Change: M92K

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131204
Gene: ENSMUSG00000020286
AA Change: M92K

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:DUF4642 50 196 1.3e-67 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit congenital heart defects associated with heterotaxy, as well as thoracic and abdominal visceral organ situs anomalies, and misaligned sternal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in 1700093K21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:1700093K21Rik APN 11 23517213 missense probably null 1.00
IGL02897:1700093K21Rik APN 11 23517308 missense probably benign 0.00
R1155:1700093K21Rik UTSW 11 23517270 missense possibly damaging 0.95
R1677:1700093K21Rik UTSW 11 23517357 missense probably benign 0.16
R3983:1700093K21Rik UTSW 11 23517220 missense possibly damaging 0.87
R5485:1700093K21Rik UTSW 11 23517378 missense probably benign 0.05
R5589:1700093K21Rik UTSW 11 23518066 missense probably benign 0.25
R5678:1700093K21Rik UTSW 11 23516529 missense probably damaging 1.00
R5783:1700093K21Rik UTSW 11 23518787 missense probably damaging 0.99
R5996:1700093K21Rik UTSW 11 23518928 start codon destroyed probably null 0.53
R6520:1700093K21Rik UTSW 11 23517285 missense possibly damaging 0.63
R6930:1700093K21Rik UTSW 11 23516563 missense probably benign 0.03
R7432:1700093K21Rik UTSW 11 23518839 missense probably benign 0.07
R7558:1700093K21Rik UTSW 11 23516285 utr 3 prime probably null
Predicted Primers PCR Primer
(F):5'- CTGAGCAACCCCTGAAAGAG -3'
(R):5'- AGAAATGACATCCAGTTGGCAAC -3'

Sequencing Primer
(F):5'- GAGAACATGTCACCTCATGGTTG -3'
(R):5'- GGCAACAAATAGTCTCTGAACTC -3'
Posted On2017-07-14