Incidental Mutation 'R6072:Krt14'
ID482547
Institutional Source Beutler Lab
Gene Symbol Krt14
Ensembl Gene ENSMUSG00000045545
Gene Namekeratin 14
SynonymsKrt1-14, K14, Cytokeratin 14, Krt-1.14, epidermolysis bullosa simplex, Dowling-Meara, Koebner
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100203162-100207548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100207166 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 97 (G97D)
Ref Sequence ENSEMBL: ENSMUSP00000007272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007272]
Predicted Effect unknown
Transcript: ENSMUST00000007272
AA Change: G97D
SMART Domains Protein: ENSMUSP00000007272
Gene: ENSMUSG00000045545
AA Change: G97D

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 120 431 5.67e-176 SMART
low complexity region 433 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137265
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations develop extensive skin blistering after birth and die by 2 days of age. If keratin 16 is also expressed in skin, development is normal but later alopecia, chronic skin ulcers and stratified epithelial defects occur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr723 A T 14: 49,929,149 Y132N probably damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Krt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Krt14 APN 11 100204416 splice site probably benign
R0449:Krt14 UTSW 11 100207395 missense unknown
R0848:Krt14 UTSW 11 100204264 missense probably damaging 1.00
R1302:Krt14 UTSW 11 100203347 missense probably damaging 1.00
R2024:Krt14 UTSW 11 100207218 missense unknown
R2088:Krt14 UTSW 11 100204123 missense possibly damaging 0.81
R2161:Krt14 UTSW 11 100207113 missense unknown
R3878:Krt14 UTSW 11 100207089 missense possibly damaging 0.56
R5015:Krt14 UTSW 11 100207206 nonsense probably null
R5314:Krt14 UTSW 11 100204700 missense probably damaging 1.00
R5474:Krt14 UTSW 11 100204745 missense probably damaging 1.00
R5698:Krt14 UTSW 11 100205625 missense probably benign 0.44
R5707:Krt14 UTSW 11 100204758 missense possibly damaging 0.77
R6523:Krt14 UTSW 11 100205097 missense possibly damaging 0.81
R6622:Krt14 UTSW 11 100203960 missense probably benign 0.00
R7082:Krt14 UTSW 11 100203341 missense possibly damaging 0.95
R7239:Krt14 UTSW 11 100204255 missense probably benign 0.03
R7350:Krt14 UTSW 11 100205100 nonsense probably null
X0020:Krt14 UTSW 11 100205106 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGAATCTTCACCTCCAGTTCAG -3'
(R):5'- CATGAAGGGCTCTTGTGGTATC -3'

Sequencing Primer
(F):5'- ACCTCCAGTTCAGTGTTGGC -3'
(R):5'- TCCTGGCTGGAGGATCCTG -3'
Posted On2017-07-14