Incidental Mutation 'R6072:Olfr723'
ID482549
Institutional Source Beutler Lab
Gene Symbol Olfr723
Ensembl Gene ENSMUSG00000093825
Gene Nameolfactory receptor 723
SynonymsGA_x6K02T2PMLR-5600424-5599495, MOR247-4, MOR247-3P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6072 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location49928563-49931787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49929149 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 132 (Y132N)
Ref Sequence ENSEMBL: ENSMUSP00000145863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164157] [ENSMUST00000206058]
Predicted Effect probably damaging
Transcript: ENSMUST00000164157
AA Change: Y132N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129254
Gene: ENSMUSG00000093825
AA Change: Y132N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.4e-12 PFAM
Pfam:7tm_1 41 287 4.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206058
AA Change: Y132N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,357 M92K probably benign Het
3110001I22Rik T C 16: 13,677,489 S151P probably damaging Het
Abca15 T A 7: 120,388,258 C1256S probably damaging Het
Asic2 A G 11: 80,894,088 S291P probably damaging Het
Asph A G 4: 9,643,533 probably null Het
Ccdc173 A T 2: 69,772,058 D336E probably benign Het
Ccdc57 T A 11: 120,902,075 K284N probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Dopey1 G A 9: 86,507,697 S558N probably benign Het
F830045P16Rik T A 2: 129,472,694 Q221L probably damaging Het
Gm10146 A G 10: 78,393,498 noncoding transcript Het
Gys2 T G 6: 142,428,537 D594A probably damaging Het
Irf9 A G 14: 55,605,827 E114G probably damaging Het
Itpr2 T G 6: 146,347,111 K1082T probably damaging Het
Krt14 C T 11: 100,207,166 G97D unknown Het
Lmo7 A T 14: 101,929,336 probably benign Het
Nckap5l A T 15: 99,426,654 L656Q probably damaging Het
Ndufs8 T C 19: 3,909,275 T129A probably damaging Het
Nosip G A 7: 45,076,648 V187M possibly damaging Het
Olfr830 G A 9: 18,875,422 V29I probably benign Het
Phf3 A C 1: 30,830,688 N426K probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpru A G 4: 131,776,228 S1164P probably damaging Het
Rcan1 T C 16: 92,465,927 D51G probably benign Het
Rem1 A G 2: 152,634,517 T232A probably benign Het
Slc1a3 T A 15: 8,708,568 I59F probably damaging Het
Slc23a4 T C 6: 34,948,422 K491E probably benign Het
Slc6a5 T A 7: 49,912,195 D158E probably damaging Het
Smarca4 A G 9: 21,700,121 N1510S probably damaging Het
Taf1d T C 9: 15,311,560 S241P probably benign Het
Thada T C 17: 84,192,006 D1921G possibly damaging Het
Tmem147 A T 7: 30,728,020 M99K possibly damaging Het
Tulp1 T C 17: 28,363,784 E130G possibly damaging Het
Tyw1 T C 5: 130,267,911 V123A possibly damaging Het
Wdr75 T C 1: 45,799,051 V40A probably damaging Het
Zfp683 T C 4: 134,055,746 Y174H probably benign Het
Other mutations in Olfr723
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Olfr723 APN 14 49929098 missense probably damaging 1.00
IGL02481:Olfr723 APN 14 49928707 missense probably damaging 1.00
IGL03269:Olfr723 APN 14 49928708 missense probably damaging 1.00
IGL03330:Olfr723 APN 14 49929221 missense probably damaging 1.00
R1782:Olfr723 UTSW 14 49928639 missense probably benign
R2061:Olfr723 UTSW 14 49929021 missense possibly damaging 0.78
R3014:Olfr723 UTSW 14 49929032 missense probably benign 0.00
R4134:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4135:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4212:Olfr723 UTSW 14 49928889 nonsense probably null
R4774:Olfr723 UTSW 14 49929269 missense probably damaging 1.00
R4951:Olfr723 UTSW 14 49929058 nonsense probably null
R4965:Olfr723 UTSW 14 49928897 missense probably benign 0.01
R5254:Olfr723 UTSW 14 49928779 missense probably damaging 0.99
R5306:Olfr723 UTSW 14 49929550 start gained probably benign
R5502:Olfr723 UTSW 14 49929536 missense probably benign
R5799:Olfr723 UTSW 14 49929040 missense probably damaging 1.00
R6062:Olfr723 UTSW 14 49928662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCTTGATTACCAGGGG -3'
(R):5'- GTCACAGTGGCAGCTAATTCTG -3'

Sequencing Primer
(F):5'- CTTGATTACCAGGGGAAGGTC -3'
(R):5'- GGAAACCTCTCCTTCCTGGACATG -3'
Posted On2017-07-14