Incidental Mutation 'R6073:Tie1'
ID482565
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118482390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 398 (V398A)
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably benign
Transcript: ENSMUST00000047421
AA Change: V398A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: V398A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably benign
Transcript: ENSMUST00000184261
AA Change: V398A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191
AA Change: V398A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
R7410:Tie1 UTSW 4 118479877 missense probably benign
R7486:Tie1 UTSW 4 118479904 critical splice acceptor site probably null
R7637:Tie1 UTSW 4 118472978 missense probably damaging 1.00
R7737:Tie1 UTSW 4 118478857 splice site probably null
R7878:Tie1 UTSW 4 118478424 missense probably damaging 1.00
R8012:Tie1 UTSW 4 118486481 missense possibly damaging 0.77
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Z1176:Tie1 UTSW 4 118474177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATTTGGTAGAGCCTACTC -3'
(R):5'- TGACAGTTCGTTCCTTGGATCC -3'

Posted On2017-07-14