Incidental Mutation 'R6073:Cc2d2a'
ID 482569
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Name coiled-coil and C2 domain containing 2A
Synonyms b2b1035Clo, 5730509K17Rik
MMRRC Submission 044234-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.906) question?
Stock # R6073 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 43819715-43898317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43887317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1249 (T1249M)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
AlphaFold Q8CFW7
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: T1310M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: T1310M

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: T1249M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: T1249M

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 A T 18: 62,312,537 (GRCm39) M96K probably benign Het
Aox1 T C 1: 58,143,668 (GRCm39) probably null Het
Bnip5 A T 17: 29,123,597 (GRCm39) V367D probably damaging Het
C3 C T 17: 57,513,223 (GRCm39) G183R probably null Het
Cad A G 5: 31,219,906 (GRCm39) T753A possibly damaging Het
Cd74 G A 18: 60,944,558 (GRCm39) probably null Het
Cenpc1 A G 5: 86,206,012 (GRCm39) probably null Het
Cenpe T A 3: 134,965,834 (GRCm39) L2104* probably null Het
Cttnbp2 A G 6: 18,434,232 (GRCm39) I542T probably damaging Het
Cttnbp2 T C 6: 18,448,368 (GRCm39) D97G probably benign Het
Dnah10 A G 5: 124,896,274 (GRCm39) D3546G probably benign Het
Dscaml1 G A 9: 45,361,881 (GRCm39) V214I probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Epb41l2 T G 10: 25,377,730 (GRCm39) H597Q probably damaging Het
Erbin G A 13: 103,981,429 (GRCm39) Q499* probably null Het
Erc2 A T 14: 27,733,593 (GRCm39) I556F probably benign Het
Fscn2 G T 11: 120,252,613 (GRCm39) E27* probably null Het
Fsd1l A G 4: 53,679,994 (GRCm39) T231A probably damaging Het
G6pc1 T A 11: 101,258,802 (GRCm39) N60K probably benign Het
Gm43302 A G 5: 105,438,825 (GRCm39) V21A probably damaging Het
Heatr3 G T 8: 88,864,768 (GRCm39) A41S probably benign Het
Hrct1 T C 4: 43,727,543 (GRCm39) probably benign Het
Ihh T C 1: 74,990,438 (GRCm39) probably benign Het
Jph3 A T 8: 122,480,291 (GRCm39) Y323F probably damaging Het
Kcnj5 T C 9: 32,229,096 (GRCm39) D34G probably damaging Het
Magi2 G A 5: 20,774,286 (GRCm39) E231K probably damaging Het
Muc5b A C 7: 141,412,025 (GRCm39) Y1657S unknown Het
Muc5b G A 7: 141,402,797 (GRCm39) C667Y unknown Het
Myo10 G A 15: 25,736,728 (GRCm39) C459Y probably damaging Het
Nemp1 A G 10: 127,525,112 (GRCm39) K40E probably benign Het
Nipsnap1 T C 11: 4,838,895 (GRCm39) F107S possibly damaging Het
Ntrk1 T C 3: 87,698,677 (GRCm39) probably null Het
Pabpc1 A G 15: 36,600,895 (GRCm39) I305T probably damaging Het
Piezo2 A G 18: 63,145,716 (GRCm39) F2736S probably damaging Het
Pnldc1 T C 17: 13,109,250 (GRCm39) Y450C probably null Het
Polr2g A T 19: 8,774,673 (GRCm39) V70E probably damaging Het
Pramel23 T C 4: 143,424,838 (GRCm39) I202V probably damaging Het
Prpf8 T C 11: 75,384,848 (GRCm39) probably null Het
Rfxap T C 3: 54,714,708 (GRCm39) Y130C probably damaging Het
Rpl3l A G 17: 24,949,861 (GRCm39) E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,113 (GRCm39) probably benign Het
Slc39a10 T C 1: 46,871,772 (GRCm39) D389G possibly damaging Het
Sorbs1 T C 19: 40,303,101 (GRCm39) H496R probably damaging Het
Spast G A 17: 74,680,300 (GRCm39) V420M probably damaging Het
Spata13 C T 14: 60,987,470 (GRCm39) T876I probably damaging Het
Spata31d1a T A 13: 59,850,808 (GRCm39) N440I probably damaging Het
Tdrd1 G T 19: 56,831,655 (GRCm39) E349* probably null Het
Tie1 A G 4: 118,339,587 (GRCm39) V398A probably benign Het
Tmem255b T A 8: 13,506,958 (GRCm39) L229Q probably damaging Het
Tmem59 T A 4: 107,050,598 (GRCm39) probably null Het
Trim3 G A 7: 105,266,746 (GRCm39) R479C probably damaging Het
Ucp2 G A 7: 100,147,338 (GRCm39) V131M possibly damaging Het
Vars1 A G 17: 35,220,505 (GRCm39) D29G probably benign Het
Vmn2r43 T C 7: 8,258,184 (GRCm39) K343R probably benign Het
Washc5 T C 15: 59,207,019 (GRCm39) K1085E possibly damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Zfp963 A T 8: 70,195,853 (GRCm39) C86* probably null Het
Zfp977 A G 7: 42,230,165 (GRCm39) I120T probably benign Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43,881,722 (GRCm39) splice site probably benign
IGL00937:Cc2d2a APN 5 43,845,464 (GRCm39) critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43,846,345 (GRCm39) missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43,881,126 (GRCm39) missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43,841,527 (GRCm39) missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43,846,311 (GRCm39) missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43,845,579 (GRCm39) missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43,840,457 (GRCm39) missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43,842,590 (GRCm39) splice site probably null
IGL02364:Cc2d2a APN 5 43,892,792 (GRCm39) missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43,840,547 (GRCm39) splice site probably benign
IGL02458:Cc2d2a APN 5 43,875,896 (GRCm39) missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43,846,252 (GRCm39) splice site probably benign
IGL02834:Cc2d2a APN 5 43,871,863 (GRCm39) nonsense probably null
IGL02940:Cc2d2a APN 5 43,885,636 (GRCm39) splice site probably null
IGL03003:Cc2d2a APN 5 43,828,608 (GRCm39) missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43,889,721 (GRCm39) missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43,892,799 (GRCm39) splice site probably benign
P0028:Cc2d2a UTSW 5 43,841,541 (GRCm39) missense probably benign
R0193:Cc2d2a UTSW 5 43,893,460 (GRCm39) missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43,894,854 (GRCm39) missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43,845,608 (GRCm39) splice site probably null
R0243:Cc2d2a UTSW 5 43,853,980 (GRCm39) splice site probably benign
R0317:Cc2d2a UTSW 5 43,864,243 (GRCm39) critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43,860,636 (GRCm39) missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43,881,729 (GRCm39) splice site probably benign
R0624:Cc2d2a UTSW 5 43,887,371 (GRCm39) missense probably benign
R0634:Cc2d2a UTSW 5 43,838,723 (GRCm39) splice site probably benign
R1503:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43,879,812 (GRCm39) missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43,896,713 (GRCm39) missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43,881,030 (GRCm39) splice site probably null
R1715:Cc2d2a UTSW 5 43,876,003 (GRCm39) missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43,871,873 (GRCm39) missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43,845,594 (GRCm39) missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43,898,170 (GRCm39) missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43,863,564 (GRCm39) missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43,883,715 (GRCm39) critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43,841,375 (GRCm39) splice site probably benign
R2244:Cc2d2a UTSW 5 43,889,775 (GRCm39) missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43,861,230 (GRCm39) missense probably benign
R2442:Cc2d2a UTSW 5 43,828,647 (GRCm39) critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43,892,737 (GRCm39) missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43,842,593 (GRCm39) splice site probably null
R3147:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43,866,497 (GRCm39) missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43,893,451 (GRCm39) missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43,869,668 (GRCm39) missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43,876,056 (GRCm39) missense probably benign
R3870:Cc2d2a UTSW 5 43,876,033 (GRCm39) nonsense probably null
R4334:Cc2d2a UTSW 5 43,840,476 (GRCm39) missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43,896,665 (GRCm39) missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43,845,563 (GRCm39) missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43,877,775 (GRCm39) missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43,863,555 (GRCm39) missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43,887,383 (GRCm39) missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43,852,518 (GRCm39) missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43,866,433 (GRCm39) missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43,887,249 (GRCm39) missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43,879,804 (GRCm39) missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43,869,760 (GRCm39) missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43,873,117 (GRCm39) missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43,869,768 (GRCm39) missense probably benign
R5912:Cc2d2a UTSW 5 43,877,772 (GRCm39) missense probably damaging 0.97
R6084:Cc2d2a UTSW 5 43,826,015 (GRCm39) missense probably benign
R6142:Cc2d2a UTSW 5 43,860,540 (GRCm39) missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43,828,577 (GRCm39) missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43,873,118 (GRCm39) missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43,861,416 (GRCm39) missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43,896,754 (GRCm39) missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43,876,019 (GRCm39) missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43,838,673 (GRCm39) missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43,860,557 (GRCm39) missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43,875,927 (GRCm39) missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43,891,271 (GRCm39) missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43,857,321 (GRCm39) nonsense probably null
R7071:Cc2d2a UTSW 5 43,866,455 (GRCm39) missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43,840,481 (GRCm39) missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43,887,332 (GRCm39) missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43,864,188 (GRCm39) missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43,896,651 (GRCm39) missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43,852,638 (GRCm39) critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43,863,442 (GRCm39) missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43,869,781 (GRCm39) missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43,867,896 (GRCm39) missense probably benign
R8179:Cc2d2a UTSW 5 43,857,295 (GRCm39) missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43,893,487 (GRCm39) missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43,845,570 (GRCm39) missense probably damaging 0.97
R8480:Cc2d2a UTSW 5 43,842,486 (GRCm39) splice site probably null
R8482:Cc2d2a UTSW 5 43,852,581 (GRCm39) missense probably damaging 1.00
R8731:Cc2d2a UTSW 5 43,892,788 (GRCm39) missense probably damaging 1.00
R8780:Cc2d2a UTSW 5 43,896,692 (GRCm39) missense probably damaging 1.00
R8784:Cc2d2a UTSW 5 43,860,645 (GRCm39) missense possibly damaging 0.90
R8871:Cc2d2a UTSW 5 43,857,285 (GRCm39) missense possibly damaging 0.71
R8972:Cc2d2a UTSW 5 43,867,884 (GRCm39) missense probably benign
R9122:Cc2d2a UTSW 5 43,831,081 (GRCm39) missense probably null 0.07
R9125:Cc2d2a UTSW 5 43,860,563 (GRCm39) missense probably benign
R9203:Cc2d2a UTSW 5 43,891,179 (GRCm39) missense probably benign 0.01
R9310:Cc2d2a UTSW 5 43,852,488 (GRCm39) missense probably damaging 1.00
R9343:Cc2d2a UTSW 5 43,875,999 (GRCm39) missense probably damaging 1.00
R9353:Cc2d2a UTSW 5 43,860,691 (GRCm39) critical splice donor site probably null
Z1177:Cc2d2a UTSW 5 43,860,546 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTTGCCAATTCACTACTC -3'
(R):5'- TACGTGTTCTGAGATGCCTG -3'

Posted On 2017-07-14