Incidental Mutation 'R6073:Ucp2'
ID482579
Institutional Source Beutler Lab
Gene Symbol Ucp2
Ensembl Gene ENSMUSG00000033685
Gene Nameuncoupling protein 2 (mitochondrial, proton carrier)
Synonyms
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100493337-100502020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100498131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 131 (V131M)
Ref Sequence ENSEMBL: ENSMUSP00000120967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126534] [ENSMUST00000129324] [ENSMUST00000133044] [ENSMUST00000153287] [ENSMUST00000207748] [ENSMUST00000207405] [ENSMUST00000154516]
PDB Structure
Structure of the mitochondrial uncoupling protein 2 determined by NMR molecular fragment replacement [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000054923
SMART Domains Protein: ENSMUSP00000059074
Gene: ENSMUSG00000030708

DomainStartEndE-ValueType
DnaJ 3 60 3.52e-23 SMART
Pfam:DnaJ_C 140 299 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126381
Predicted Effect possibly damaging
Transcript: ENSMUST00000126534
AA Change: V131M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120967
Gene: ENSMUSG00000033685
AA Change: V131M

DomainStartEndE-ValueType
Pfam:Mito_carr 10 111 1.3e-21 PFAM
Pfam:Mito_carr 112 208 2e-27 PFAM
Pfam:Mito_carr 211 302 5.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129324
SMART Domains Protein: ENSMUSP00000115648
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 65 8.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130534
Predicted Effect possibly damaging
Transcript: ENSMUST00000133044
AA Change: V131M

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115598
Gene: ENSMUSG00000033685
AA Change: V131M

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 2.6e-23 PFAM
Pfam:Mito_carr 112 172 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151221
Predicted Effect probably benign
Transcript: ENSMUST00000153287
SMART Domains Protein: ENSMUSP00000115953
Gene: ENSMUSG00000033685

DomainStartEndE-ValueType
Pfam:Mito_carr 9 111 6.4e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207748
AA Change: V131M

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000207405
Predicted Effect probably benign
Transcript: ENSMUST00000154516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207890
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed in many tissues, with the greatest expression in skeletal muscle. It is thought to play a role in nonshivering thermogenesis, obesity and diabetes. Chromosomal order is 5'-UCP3-UCP2-3'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have elevated pancreatic islet cell ATP levels and increased glucose-stimulated secretion of insulin. Homozygotes also show reduced mitochondrial proton leak in thymocytes and increased resistance to infection by Toxoplasma gondii. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Ucp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Ucp2 APN 7 100498422 missense probably benign
IGL02184:Ucp2 APN 7 100499322 missense probably benign
IGL02370:Ucp2 APN 7 100498384 missense probably damaging 0.96
IGL02449:Ucp2 APN 7 100498810 missense probably damaging 1.00
R1808:Ucp2 UTSW 7 100498814 missense probably damaging 0.97
R1809:Ucp2 UTSW 7 100498399 missense probably damaging 0.98
R2384:Ucp2 UTSW 7 100498254 missense probably benign
R2508:Ucp2 UTSW 7 100498413 missense probably benign
R2866:Ucp2 UTSW 7 100497252 missense probably benign 0.31
R4400:Ucp2 UTSW 7 100499350 makesense probably null
R5022:Ucp2 UTSW 7 100498372 missense possibly damaging 0.74
R6530:Ucp2 UTSW 7 100498223 missense probably benign
R7381:Ucp2 UTSW 7 100498369 missense possibly damaging 0.94
R7572:Ucp2 UTSW 7 100497307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAAGAGTGATCTAGAGCCTC -3'
(R):5'- CATTACGGGCAACATTGGGAG -3'

Posted On2017-07-14