Incidental Mutation 'R0517:Vmn2r120'
ID 48258
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Name vomeronasal 2, receptor 120
Synonyms EG224916
MMRRC Submission 038710-MU
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0517 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 57508783-57545314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57508949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 802 (Y802C)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
AlphaFold A0A3Q4EG79
Predicted Effect probably damaging
Transcript: ENSMUST00000165781
AA Change: Y802C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: Y802C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik T A 17: 36,981,132 probably benign Het
Acer1 T C 17: 56,955,569 T194A probably benign Het
Adamts1 C A 16: 85,800,353 D10Y possibly damaging Het
Adamts7 T C 9: 90,199,858 V1612A probably benign Het
Adcyap1r1 T A 6: 55,491,297 S373T probably damaging Het
Armc4 A C 18: 7,223,621 L474R probably damaging Het
Asic5 A T 3: 82,009,526 I266F probably benign Het
Cacna1d A T 14: 30,179,275 I274K probably damaging Het
Camsap2 G T 1: 136,293,388 Q238K possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cerk G A 15: 86,156,648 T170I probably damaging Het
Cyp27b1 T C 10: 127,050,116 probably null Het
Cyp2c65 T C 19: 39,082,348 probably benign Het
Dennd5a A G 7: 109,934,761 S75P probably damaging Het
Dhx9 C T 1: 153,478,916 A146T possibly damaging Het
Dpysl5 A G 5: 30,778,066 D171G probably damaging Het
Dsg3 A G 18: 20,529,025 N449S probably benign Het
Eps8l3 T C 3: 107,883,460 S189P probably benign Het
Exph5 A G 9: 53,372,762 E381G probably benign Het
Fam208b T A 13: 3,566,964 T2367S possibly damaging Het
Fbxo46 A G 7: 19,136,874 M473V possibly damaging Het
Fgf14 G A 14: 123,983,784 P203S probably damaging Het
Foxf2 C T 13: 31,626,243 A55V unknown Het
Galnt5 T G 2: 58,035,373 probably benign Het
Glis2 T C 16: 4,611,552 L181P probably damaging Het
Gm1000 T G 12: 104,476,408 probably benign Het
Helz2 A G 2: 181,227,770 S2959P probably benign Het
Hyal6 A G 6: 24,734,853 N262D probably benign Het
Lgr4 T C 2: 110,011,320 L526P probably damaging Het
Mapk1 A T 16: 17,016,046 I88F probably benign Het
Mpg A T 11: 32,231,853 H287L probably benign Het
Mpp4 A T 1: 59,124,727 Y489* probably null Het
Mpzl1 T C 1: 165,601,790 E224G probably damaging Het
Myh10 A G 11: 68,811,599 probably null Het
Olfr1034 T C 2: 86,047,204 S241P probably damaging Het
Olfr1340 T A 4: 118,726,634 I129K probably damaging Het
Paip1 T A 13: 119,447,790 F196I probably damaging Het
Pde3a A T 6: 141,498,657 K1064* probably null Het
Pira2 A T 7: 3,844,197 probably benign Het
Pros1 A G 16: 62,903,518 S210G probably benign Het
Rbm15 A T 3: 107,331,369 L571Q probably damaging Het
Scn1a T A 2: 66,302,407 T1194S possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Serpina1e G A 12: 103,949,227 T240I probably benign Het
Setx T G 2: 29,157,133 S1874R probably benign Het
Sgsm2 G T 11: 74,867,651 T256K possibly damaging Het
Slc44a1 T C 4: 53,542,366 V300A probably damaging Het
Spata46 A G 1: 170,311,609 Y59C probably damaging Het
Supt3 T C 17: 45,119,271 F404L probably benign Het
Tars T A 15: 11,394,366 K62* probably null Het
Tas2r139 A C 6: 42,141,491 T186P probably damaging Het
Tc2n C T 12: 101,649,195 S457N probably damaging Het
Tox4 A T 14: 52,292,628 S582C probably benign Het
Trappc12 T C 12: 28,697,134 probably benign Het
Ubqlnl G T 7: 104,148,638 Q551K probably damaging Het
Ubr4 A G 4: 139,392,124 T205A probably benign Het
Urb1 G A 16: 90,777,422 Q924* probably null Het
Vmn1r49 A G 6: 90,072,738 L94P probably damaging Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
R8882:Vmn2r120 UTSW 17 57545229 missense probably benign 0.01
R9134:Vmn2r120 UTSW 17 57525093 missense probably damaging 1.00
R9161:Vmn2r120 UTSW 17 57524864 missense
R9336:Vmn2r120 UTSW 17 57525201 missense possibly damaging 0.91
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCTCTCAGTCCTTTAAAAGAACC -3'
(R):5'- CCCAACATGGCAACTTGCATTCTAC -3'

Sequencing Primer
(F):5'- TCCTTTAAAAGAACCATTCTTAGGTC -3'
(R):5'- TTTCAGAAGCACTGTACCAGG -3'
Posted On 2013-06-12