Incidental Mutation 'R6073:Nemp1'
ID482590
Institutional Source Beutler Lab
Gene Symbol Nemp1
Ensembl Gene ENSMUSG00000040195
Gene Namenuclear envelope integral membrane protein 1
SynonymsTmem194
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127666901-127701049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127689243 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 40 (K40E)
Ref Sequence ENSEMBL: ENSMUSP00000113473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000118612] [ENSMUST00000118728]
Predicted Effect probably benign
Transcript: ENSMUST00000048099
AA Change: K89E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195
AA Change: K89E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118612
AA Change: K89E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113337
Gene: ENSMUSG00000040195
AA Change: K89E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 149 325 4.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118728
AA Change: K40E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195
AA Change: K40E

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Nemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Nemp1 APN 10 127692999 missense probably benign 0.02
Assassin UTSW 10 127689343 nonsense probably null
Brightside UTSW 10 127689450 splice site probably null
Cheery UTSW 10 127677198 missense possibly damaging 0.86
PIT4453001:Nemp1 UTSW 10 127696254 missense probably benign 0.00
R0815:Nemp1 UTSW 10 127693024 missense probably damaging 0.99
R1719:Nemp1 UTSW 10 127696248 missense probably damaging 1.00
R2007:Nemp1 UTSW 10 127693577 missense probably benign 0.02
R2042:Nemp1 UTSW 10 127696334 missense possibly damaging 0.46
R3938:Nemp1 UTSW 10 127695473 missense probably damaging 1.00
R4548:Nemp1 UTSW 10 127696344 missense probably benign 0.00
R4726:Nemp1 UTSW 10 127694593 missense probably benign 0.01
R4981:Nemp1 UTSW 10 127693530 missense probably damaging 1.00
R5048:Nemp1 UTSW 10 127690935 critical splice donor site probably null
R5784:Nemp1 UTSW 10 127677198 missense possibly damaging 0.86
R6171:Nemp1 UTSW 10 127689450 splice site probably null
R6294:Nemp1 UTSW 10 127694522 missense possibly damaging 0.87
R7249:Nemp1 UTSW 10 127693526 missense probably damaging 1.00
R7269:Nemp1 UTSW 10 127695476 missense probably damaging 1.00
R7316:Nemp1 UTSW 10 127689343 nonsense probably null
R7468:Nemp1 UTSW 10 127693054 missense possibly damaging 0.56
R7998:Nemp1 UTSW 10 127693489 missense probably damaging 1.00
R8342:Nemp1 UTSW 10 127693029 missense probably benign 0.00
X0011:Nemp1 UTSW 10 127689311 nonsense probably null
Z1177:Nemp1 UTSW 10 127693519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAACAAGAAATTGTAGCAGCAGCC -3'
(R):5'- CACTGTACGTGGTGTCCTTC -3'

Posted On2017-07-14