Incidental Mutation 'R6073:Pabpc1'
ID482600
Institutional Source Beutler Lab
Gene Symbol Pabpc1
Ensembl Gene ENSMUSG00000022283
Gene Namepoly(A) binding protein, cytoplasmic 1
SynonymsPabp1, Pabpl1
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36595661-36609668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36600651 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 305 (I305T)
Ref Sequence ENSEMBL: ENSMUSP00000001809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001809]
Predicted Effect probably damaging
Transcript: ENSMUST00000001809
AA Change: I305T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001809
Gene: ENSMUSG00000022283
AA Change: I305T

DomainStartEndE-ValueType
RRM 12 85 6.86e-22 SMART
RRM 100 171 2.72e-25 SMART
RRM 192 264 5.39e-29 SMART
RRM 295 366 5.83e-25 SMART
low complexity region 455 462 N/A INTRINSIC
low complexity region 492 509 N/A INTRINSIC
PolyA 554 617 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147116
Predicted Effect probably benign
Transcript: ENSMUST00000155116
SMART Domains Protein: ENSMUSP00000117063
Gene: ENSMUSG00000022283

DomainStartEndE-ValueType
PolyA 36 99 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226867
Meta Mutation Damage Score 0.3706 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spast G A 17: 74,373,305 V420M probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Pabpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01605:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01973:Pabpc1 APN 15 36599275 missense probably benign 0.13
R0309:Pabpc1 UTSW 15 36597493 missense possibly damaging 0.93
R0667:Pabpc1 UTSW 15 36598031 missense probably benign
R0883:Pabpc1 UTSW 15 36599054 unclassified probably benign
R1682:Pabpc1 UTSW 15 36605541 missense possibly damaging 0.75
R1749:Pabpc1 UTSW 15 36608340 missense probably damaging 1.00
R4731:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4732:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4733:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4825:Pabpc1 UTSW 15 36597011 missense probably damaging 0.98
R5324:Pabpc1 UTSW 15 36600625 missense probably damaging 1.00
R5328:Pabpc1 UTSW 15 36602877 missense probably benign 0.03
R5711:Pabpc1 UTSW 15 36605830 missense probably benign 0.03
R6751:Pabpc1 UTSW 15 36597534 missense possibly damaging 0.71
R7632:Pabpc1 UTSW 15 36597968 frame shift probably null
R8042:Pabpc1 UTSW 15 36598309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGACTACCCAGAATGAAC -3'
(R):5'- CAGGTTCATATTTACTCGAACAAGC -3'

Posted On2017-07-14