Incidental Mutation 'R6073:Spast'
ID482608
Institutional Source Beutler Lab
Gene Symbol Spast
Ensembl Gene ENSMUSG00000024068
Gene Namespastin
SynonymsSpg4
MMRRC Submission 044234-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6073 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location74338987-74391115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 74373305 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 420 (V420M)
Ref Sequence ENSEMBL: ENSMUSP00000153469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024869] [ENSMUST00000224711] [ENSMUST00000225549]
Predicted Effect probably damaging
Transcript: ENSMUST00000024869
AA Change: V421M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024869
Gene: ENSMUSG00000024068
AA Change: V421M

DomainStartEndE-ValueType
low complexity region 3 46 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
low complexity region 90 113 N/A INTRINSIC
MIT 114 192 4.33e-18 SMART
AAA 372 508 7.59e-17 SMART
low complexity region 513 520 N/A INTRINSIC
Pfam:Vps4_C 560 610 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224711
AA Change: V420M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225549
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with a variety of cellular activities) protein family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. The encoded ATPase may be involved in the assembly or function of nuclear protein complexes. Two transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their full length sequences have not been determined. Mutations associated with this gene cause the most frequent form of autosomal dominant spastic paraplegia 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene are sterile and display progressive axonopathy with focal axonal swellings and late onset gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik A T 17: 28,904,623 V367D probably damaging Het
Adrb2 A T 18: 62,179,466 M96K probably benign Het
Aox1 T C 1: 58,104,509 probably null Het
C3 C T 17: 57,206,223 G183R probably null Het
Cad A G 5: 31,062,562 T753A possibly damaging Het
Cc2d2a C T 5: 43,729,975 T1249M probably damaging Het
Cd74 G A 18: 60,811,486 probably null Het
Cenpc1 A G 5: 86,058,153 probably null Het
Cenpe T A 3: 135,260,073 L2104* probably null Het
Cttnbp2 A G 6: 18,434,233 I542T probably damaging Het
Cttnbp2 T C 6: 18,448,369 D97G probably benign Het
Dnah10 A G 5: 124,819,210 D3546G probably benign Het
Dscaml1 G A 9: 45,450,583 V214I probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epb41l2 T G 10: 25,501,832 H597Q probably damaging Het
Erbin G A 13: 103,844,921 Q499* probably null Het
Erc2 A T 14: 28,011,636 I556F probably benign Het
Fscn2 G T 11: 120,361,787 E27* probably null Het
Fsd1l A G 4: 53,679,994 T231A probably damaging Het
G6pc T A 11: 101,367,976 N60K probably benign Het
Gm13089 T C 4: 143,698,268 I202V probably damaging Het
Gm43302 A G 5: 105,290,959 V21A probably damaging Het
Heatr3 G T 8: 88,138,140 A41S probably benign Het
Hrct1 T C 4: 43,727,543 probably benign Het
Ihh T C 1: 74,951,279 probably benign Het
Jph3 A T 8: 121,753,552 Y323F probably damaging Het
Kcnj5 T C 9: 32,317,800 D34G probably damaging Het
Magi2 G A 5: 20,569,288 E231K probably damaging Het
Muc5b G A 7: 141,849,060 C667Y unknown Het
Muc5b A C 7: 141,858,288 Y1657S unknown Het
Myo10 G A 15: 25,736,642 C459Y probably damaging Het
Nemp1 A G 10: 127,689,243 K40E probably benign Het
Nipsnap1 T C 11: 4,888,895 F107S possibly damaging Het
Ntrk1 T C 3: 87,791,370 probably null Het
Pabpc1 A G 15: 36,600,651 I305T probably damaging Het
Piezo2 A G 18: 63,012,645 F2736S probably damaging Het
Pnldc1 T C 17: 12,890,363 Y450C probably null Het
Polr2g A T 19: 8,797,309 V70E probably damaging Het
Prpf8 T C 11: 75,494,022 probably null Het
Rfxap T C 3: 54,807,287 Y130C probably damaging Het
Rpl3l A G 17: 24,730,887 E20G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,906 probably benign Het
Slc39a10 T C 1: 46,832,612 D389G possibly damaging Het
Sorbs1 T C 19: 40,314,657 H496R probably damaging Het
Spata13 C T 14: 60,750,021 T876I probably damaging Het
Spata31d1a T A 13: 59,702,994 N440I probably damaging Het
Tdrd1 G T 19: 56,843,223 E349* probably null Het
Tie1 A G 4: 118,482,390 V398A probably benign Het
Tmem255b T A 8: 13,456,958 L229Q probably damaging Het
Tmem59 T A 4: 107,193,401 probably null Het
Trim3 G A 7: 105,617,539 R479C probably damaging Het
Ucp2 G A 7: 100,498,131 V131M possibly damaging Het
Vars A G 17: 35,001,529 D29G probably benign Het
Vmn2r43 T C 7: 8,255,185 K343R probably benign Het
Washc5 T C 15: 59,335,170 K1085E possibly damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp963 A T 8: 69,743,203 C86* probably null Het
Zfp977 A G 7: 42,580,741 I120T probably benign Het
Other mutations in Spast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Spast APN 17 74372339 splice site probably benign
R0671:Spast UTSW 17 74339451 splice site probably benign
R1170:Spast UTSW 17 74381968 critical splice acceptor site probably null
R1698:Spast UTSW 17 74356160 nonsense probably null
R2076:Spast UTSW 17 74352031 missense probably damaging 1.00
R4334:Spast UTSW 17 74352015 missense probably damaging 1.00
R4765:Spast UTSW 17 74369216 missense probably damaging 1.00
R5002:Spast UTSW 17 74369226 nonsense probably null
R5911:Spast UTSW 17 74387063 missense probably benign 0.00
R6183:Spast UTSW 17 74373358 missense probably damaging 0.99
R6450:Spast UTSW 17 74368840 missense probably benign 0.01
R6819:Spast UTSW 17 74367286 missense possibly damaging 0.47
R6821:Spast UTSW 17 74351962 missense probably benign 0.02
R7349:Spast UTSW 17 74373324 missense probably damaging 0.99
R7611:Spast UTSW 17 74369203 missense probably damaging 1.00
R7715:Spast UTSW 17 74368926 missense probably benign 0.01
R8348:Spast UTSW 17 74359298 missense probably benign 0.41
R8448:Spast UTSW 17 74359298 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGCTCCCTAACGTGGCTATC -3'
(R):5'- AGCCCGTCATTTTAATATGCATCTC -3'

Posted On2017-07-14