Incidental Mutation 'R6074:Slc39a12'
ID482621
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 14407479 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 321 (Q321*)
Ref Sequence ENSEMBL: ENSMUSP00000110379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731]
Predicted Effect probably null
Transcript: ENSMUST00000082290
AA Change: Q321*
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949
AA Change: Q321*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114731
AA Change: Q321*
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949
AA Change: Q321*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3934:Slc39a12 UTSW 2 14434363 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5477:Slc39a12 UTSW 2 14389382 missense possibly damaging 0.46
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6169:Slc39a12 UTSW 2 14400233 missense possibly damaging 0.64
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7568:Slc39a12 UTSW 2 14400128 splice site probably null
R7684:Slc39a12 UTSW 2 14449859 missense probably damaging 0.99
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATGTTGTAAATTAGTCTCTGCCAG -3'
(R):5'- CCTGCTATTACGACATGCATTGTG -3'

Posted On2017-07-14