Incidental Mutation 'R6074:Galnt12'
ID482627
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47112405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 37 (V37D)
Ref Sequence ENSEMBL: ENSMUSP00000103373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably damaging
Transcript: ENSMUST00000045041
AA Change: V329D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: V329D

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107744
AA Change: V37D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774
AA Change: V37D

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Meta Mutation Damage Score 0.8939 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
R7810:Galnt12 UTSW 4 47113786 missense probably damaging 1.00
R8823:Galnt12 UTSW 4 47091928 start gained probably benign
R8871:Galnt12 UTSW 4 47108582 critical splice donor site probably null
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCGTGGATCAGAGACTC -3'
(R):5'- TCTCTCAGGTTAATTGGATATGCCTC -3'

Posted On2017-07-14