Incidental Mutation 'R0518:Cryba2'
ID48263
Institutional Source Beutler Lab
Gene Symbol Cryba2
Ensembl Gene ENSMUSG00000006546
Gene Namecrystallin, beta A2
SynonymsE130107M19Rik
MMRRC Submission 038711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R0518 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74889934-74893143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74890125 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 153 (Y153C)
Ref Sequence ENSEMBL: ENSMUSP00000006721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006721] [ENSMUST00000068631] [ENSMUST00000133833] [ENSMUST00000159232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006721
AA Change: Y153C

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006721
Gene: ENSMUSG00000006546
AA Change: Y153C

DomainStartEndE-ValueType
XTALbg 13 98 1.64e-37 SMART
XTALbg 107 195 8.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068631
SMART Domains Protein: ENSMUSP00000070878
Gene: ENSMUSG00000055197

DomainStartEndE-ValueType
ETS 46 131 2.44e-57 SMART
low complexity region 132 156 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 200 209 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133833
SMART Domains Protein: ENSMUSP00000140298
Gene: ENSMUSG00000006546

DomainStartEndE-ValueType
XTALbg 13 54 3.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159232
SMART Domains Protein: ENSMUSP00000125067
Gene: ENSMUSG00000055197

DomainStartEndE-ValueType
ETS 1 36 5.19e-3 SMART
low complexity region 37 61 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 105 114 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for an ENU-induced allele exhibit small lens and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Acaca A G 11: 84,290,286 probably null Het
Acsm5 T C 7: 119,535,800 V327A possibly damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Akr1c14 T C 13: 4,081,016 L236S probably damaging Het
Ammecr1l C T 18: 31,771,901 S65L probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Arhgef16 G T 4: 154,291,034 P168T probably damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Cacna1s C A 1: 136,076,859 D132E probably benign Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Coa3 T A 11: 101,278,890 K13M probably damaging Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crhbp C A 13: 95,443,895 probably null Het
Cryzl2 T C 1: 157,464,430 V93A probably damaging Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Cyp2r1 T G 7: 114,552,900 H274P probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx58 C T 4: 40,216,354 probably null Het
Dnd1 A G 18: 36,764,043 V350A possibly damaging Het
Dsg1b A T 18: 20,388,164 Q26L probably benign Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Fam20b C A 1: 156,687,456 V280F possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hk3 C T 13: 55,014,426 probably null Het
Hsd3b7 A G 7: 127,803,079 T330A probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Kti12 T A 4: 108,848,579 V230E possibly damaging Het
Mgat5 T A 1: 127,384,847 I241N probably damaging Het
Mkln1 A G 6: 31,468,132 N321S probably benign Het
Mllt10 T G 2: 18,071,206 probably null Het
Ms4a1 C A 19: 11,258,679 probably null Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nipsnap3b T A 4: 53,021,343 F243I probably damaging Het
Ogfod1 T A 8: 94,055,248 probably null Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
P2ry14 T A 3: 59,115,204 E287D probably damaging Het
Pank4 A T 4: 154,976,625 R510S possibly damaging Het
Pcsk6 T A 7: 65,980,167 V347E possibly damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pik3c2b C A 1: 133,105,992 P1578H probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
Ppp1r26 A G 2: 28,452,302 D648G probably damaging Het
Ptprs A G 17: 56,419,621 probably null Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Ski A G 4: 155,159,286 probably null Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Slc25a36 A T 9: 97,097,175 I71N probably damaging Het
Syne2 A C 12: 76,108,862 probably null Het
Tdrd5 C A 1: 156,262,941 W845L probably damaging Het
Tfb2m T C 1: 179,537,824 I192V possibly damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tmem211 T A 5: 113,236,007 L97* probably null Het
Trank1 A C 9: 111,333,808 D45A probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Trim9 A T 12: 70,346,585 L195Q probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn1r4 G T 6: 56,956,898 C129F probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Wdr78 A C 4: 103,064,530 Y464* probably null Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Cryba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Cryba2 APN 1 74890561 missense possibly damaging 0.64
IGL02141:Cryba2 APN 1 74892784 missense probably benign 0.11
P0035:Cryba2 UTSW 1 74890012 missense probably damaging 1.00
R1079:Cryba2 UTSW 1 74890558 missense probably damaging 1.00
R1317:Cryba2 UTSW 1 74890676 splice site probably null
R4494:Cryba2 UTSW 1 74890630 missense probably damaging 1.00
R4666:Cryba2 UTSW 1 74890048 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAATGTGGAGCCTAATGCTGGAC -3'
(R):5'- ACAACATGACGTGTGGGAAGCC -3'

Sequencing Primer
(F):5'- TAATGCTGGACTCTTCGAATGGAC -3'
(R):5'- TGTAGAAACCAGGCTCAGAC -3'
Posted On2013-06-12