Mutagenetix > Incidental Mutations

Incidental Mutation 'R0518:Cryba2'

48263

Institutional Source

Beutler Lab

Gene Symbol

Cryba2

Ensembl Gene

ENSMUSG00000006546

Gene Name

crystallin, beta A2

Synonyms

E130107M19Rik

MMRRC Submission

038711-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R0518 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74889934-74893143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74890125 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 153 (Y153C)

Ref Sequence

ENSEMBL: ENSMUSP00000006721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006721] [ENSMUST00000068631] [ENSMUST00000133833] [ENSMUST00000159232]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006721
AA Change: Y153C

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006721
Gene: ENSMUSG00000006546
AA Change: Y153C

Domain	Start	End	E-Value	Type
XTALbg	13	98	1.64e-37	SMART
XTALbg	107	195	8.79e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000068631

SMART Domains

Protein: ENSMUSP00000070878
Gene: ENSMUSG00000055197

Domain	Start	End	E-Value	Type
ETS	46	131	2.44e-57	SMART
low complexity region	132	156	N/A	INTRINSIC
low complexity region	163	175	N/A	INTRINSIC
low complexity region	200	209	N/A	INTRINSIC
low complexity region	212	229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133833

SMART Domains

Protein: ENSMUSP00000140298
Gene: ENSMUSG00000006546

Domain	Start	End	E-Value	Type
XTALbg	13	54	3.2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159232

SMART Domains

Protein: ENSMUSP00000125067
Gene: ENSMUSG00000055197

Domain	Start	End	E-Value	Type
ETS	1	36	5.19e-3	SMART
low complexity region	37	61	N/A	INTRINSIC
low complexity region	68	80	N/A	INTRINSIC
low complexity region	105	114	N/A	INTRINSIC
low complexity region	117	134	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for an ENU-induced allele exhibit small lens and cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2900011O08Rik	T	A	16: 13,986,812	S8T	possibly damaging	Het
Acaca	A	G	11: 84,290,286		probably null	Het
Acsm5	T	C	7: 119,535,800	V327A	possibly damaging	Het
Agt	C	A	8: 124,557,100	E427*	probably null	Het
Akr1c14	T	C	13: 4,081,016	L236S	probably damaging	Het
Ammecr1l	C	T	18: 31,771,901	S65L	probably benign	Het
Ankrd33b	T	C	15: 31,367,286	D36G	probably damaging	Het
Ano8	A	T	8: 71,479,258	C766S	probably benign	Het
Arhgef16	G	T	4: 154,291,034	P168T	probably damaging	Het
Asic1	C	T	15: 99,698,819	R499C	probably damaging	Het
Bank1	C	T	3: 136,213,942	C364Y	probably damaging	Het
Cacna1s	C	A	1: 136,076,859	D132E	probably benign	Het
Capn5	C	T	7: 98,132,882	R217Q	probably damaging	Het
Clasrp	A	G	7: 19,588,603	I284T	probably benign	Het
Coa3	T	A	11: 101,278,890	K13M	probably damaging	Het
Col13a1	A	T	10: 61,862,746	M512K	unknown	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Crhbp	C	A	13: 95,443,895		probably null	Het
Cryzl2	T	C	1: 157,464,430	V93A	probably damaging	Het
Ctsl	G	A	13: 64,365,218	L297F	possibly damaging	Het
Cyp2r1	T	G	7: 114,552,900	H274P	probably benign	Het
Ddx4	A	T	13: 112,624,779		probably null	Het
Ddx58	C	T	4: 40,216,354		probably null	Het
Dnd1	A	G	18: 36,764,043	V350A	possibly damaging	Het
Dsg1b	A	T	18: 20,388,164	Q26L	probably benign	Het
Fam173b	T	G	15: 31,605,957	S20R	probably benign	Het
Fam20b	C	A	1: 156,687,456	V280F	possibly damaging	Het
Foxb2	G	T	19: 16,872,456	C395*	probably null	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Gm9930	A	T	10: 9,534,803		noncoding transcript	Het
Hdac7	G	A	15: 97,806,499	Q497*	probably null	Het
Hk3	C	T	13: 55,014,426		probably null	Het
Hsd3b7	A	G	7: 127,803,079	T330A	probably benign	Het
Il20ra	A	T	10: 19,759,640	Q543L	probably damaging	Het
Itk	T	A	11: 46,360,288	D163V	probably damaging	Het
Kcnu1	T	G	8: 25,910,888	L688R	probably damaging	Het
Kng1	G	A	16: 23,060,482	A45T	possibly damaging	Het
Kti12	T	A	4: 108,848,579	V230E	possibly damaging	Het
Mgat5	T	A	1: 127,384,847	I241N	probably damaging	Het
Mkln1	A	G	6: 31,468,132	N321S	probably benign	Het
Mllt10	T	G	2: 18,071,206		probably null	Het
Ms4a1	C	A	19: 11,258,679		probably null	Het
Ngly1	C	T	14: 16,290,774	Q419*	probably null	Het
Nipsnap3b	T	A	4: 53,021,343	F243I	probably damaging	Het
Ogfod1	T	A	8: 94,055,248		probably null	Het
Olfr1381	C	T	11: 49,552,464	T239M	probably damaging	Het
Olfr624	T	A	7: 103,670,489	I181F	possibly damaging	Het
Olfr714	T	A	7: 107,074,758	L310Q	possibly damaging	Het
Olfr898	A	C	9: 38,349,203	N40T	probably damaging	Het
P2ry14	T	A	3: 59,115,204	E287D	probably damaging	Het
Pank4	A	T	4: 154,976,625	R510S	possibly damaging	Het
Pcsk6	T	A	7: 65,980,167	V347E	possibly damaging	Het
Peg3	T	C	7: 6,711,428	E265G	probably damaging	Het
Pik3c2b	C	A	1: 133,105,992	P1578H	probably damaging	Het
Pkd1	A	G	17: 24,595,219	S4188G	probably benign	Het
Ppp1r26	A	G	2: 28,452,302	D648G	probably damaging	Het
Ptprs	A	G	17: 56,419,621		probably null	Het
Rab24	A	T	13: 55,320,925		probably null	Het
Rap1gap2	A	T	11: 74,441,766	M71K	probably damaging	Het
Rergl	T	G	6: 139,496,526	K42T	probably damaging	Het
Sept5	T	C	16: 18,624,897	T92A	probably benign	Het
Ski	A	G	4: 155,159,286		probably null	Het
Slc17a8	A	G	10: 89,576,330	S414P	probably benign	Het
Slc25a36	A	T	9: 97,097,175	I71N	probably damaging	Het
Syne2	A	C	12: 76,108,862		probably null	Het
Tdrd5	C	A	1: 156,262,941	W845L	probably damaging	Het
Tfb2m	T	C	1: 179,537,824	I192V	possibly damaging	Het
Tll1	T	G	8: 64,098,471	D292A	probably damaging	Het
Tmem211	T	A	5: 113,236,007	L97*	probably null	Het
Trank1	A	C	9: 111,333,808	D45A	probably damaging	Het
Trim17	T	A	11: 58,968,494	V178E	probably damaging	Het
Trim9	A	T	12: 70,346,585	L195Q	probably damaging	Het
Ttc27	A	T	17: 74,856,549	R717S	possibly damaging	Het
Upk2	G	T	9: 44,454,121	P50Q	probably damaging	Het
Usp9y	A	T	Y: 1,307,880	C2319S	probably benign	Het
Vmn1r4	G	T	6: 56,956,898	C129F	probably benign	Het
Vmn2r100	A	T	17: 19,521,916	D184V	probably damaging	Het
Wdr78	A	C	4: 103,064,530	Y464*	probably null	Het
Xpnpep3	T	G	15: 81,427,492	I133S	possibly damaging	Het
Zfp628	A	T	7: 4,919,940	Q387L	probably damaging	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Cryba2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02064:Cryba2	APN	1	74890561	missense	possibly damaging	0.64
IGL02141:Cryba2	APN	1	74892784	missense	probably benign	0.11
P0035:Cryba2	UTSW	1	74890012	missense	probably damaging	1.00
R1079:Cryba2	UTSW	1	74890558	missense	probably damaging	1.00
R1317:Cryba2	UTSW	1	74890676	splice site	probably null
R4494:Cryba2	UTSW	1	74890630	missense	probably damaging	1.00
R4666:Cryba2	UTSW	1	74890048	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAATGTGGAGCCTAATGCTGGAC -3'
(R):5'- ACAACATGACGTGTGGGAAGCC -3'

Sequencing Primer
(F):5'- TAATGCTGGACTCTTCGAATGGAC -3'
(R):5'- TGTAGAAACCAGGCTCAGAC -3'

Posted On

2013-06-12