Incidental Mutation 'R6074:Tacc2'
ID482642
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130625435 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1283 (H1283Q)
Ref Sequence ENSEMBL: ENSMUSP00000146419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: H1283Q

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: H1283Q

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect possibly damaging
Transcript: ENSMUST00000207918
AA Change: H1283Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207999
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect possibly damaging
Transcript: ENSMUST00000215492
AA Change: H1302Q

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
aces UTSW 7 130733528 missense probably damaging 1.00
Jacks UTSW 7 130625764 missense probably damaging 0.98
kings UTSW 7 130623483 missense probably damaging 0.96
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4618:Tacc2 UTSW 7 130626216 missense probably benign 0.10
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
R7111:Tacc2 UTSW 7 130728888 missense probably benign 0.16
R7150:Tacc2 UTSW 7 130729077 missense probably benign
R7290:Tacc2 UTSW 7 130729373 missense probably benign 0.07
R7404:Tacc2 UTSW 7 130623336 missense probably benign 0.22
R7460:Tacc2 UTSW 7 130624633 missense probably benign 0.39
R7651:Tacc2 UTSW 7 130623154 missense probably benign 0.25
R7666:Tacc2 UTSW 7 130716814 start gained probably benign
R7695:Tacc2 UTSW 7 130728903 missense probably benign 0.08
R7766:Tacc2 UTSW 7 130743598 missense probably damaging 1.00
R7793:Tacc2 UTSW 7 130623113 missense probably benign 0.34
R7861:Tacc2 UTSW 7 130625431 missense probably benign 0.00
R7944:Tacc2 UTSW 7 130625431 missense probably benign 0.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTTTGGAAAATGACACC -3'
(R):5'- CCGCTATTATGCTGGTCTGC -3'

Posted On2017-07-14