Incidental Mutation 'R6074:Usp54'
ID482663
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20552099 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1394 (M1394I)
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: M1394I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: M1394I

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: M1394I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: M1394I

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tmem74 A G 15: 43,866,738 V303A possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 unclassified probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
R7859:Usp54 UTSW 14 20588136 missense probably benign 0.24
R7942:Usp54 UTSW 14 20588136 missense probably benign 0.24
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGGAGTGAAGCAAGGTATC -3'
(R):5'- ACATCCTGCCATGTTAACCC -3'

Posted On2017-07-14